Category: Divers

Poutine lève les restrictions Covid

par Boris Guenadevitch Karpov.

Allant à contre-courant de la paranoïa des gouvernements occidentaux, Vladimir Poutine a annoncé ce jour le retour à la normale en Russie :

« En Russie, la situation avec le coronavirus se stabilise ; les restrictions imposées en lien avec la « pandémie » peuvent être progressivement levées. En général, la situation épidémiologique dans le pays se stabilise progressivement. Ce matin, j’ai écouté les rapports : nous avons déjà le nombre de guéris supérieur au nombre de malades. Le nombre de personnes infectées diminue, il est à moins de 20 pour mille. Cela permet de supprimer soigneusement les restrictions imposées ».

Actuellement dans la plupart des régions de la Fédération de Russie il y a déjà très peu de restrictions depuis l’été dernier, comparativement aux pays occidentaux : Tous les services et commerces fonctionnent (bars et restaurants doivent dans plusieurs régions fermer à 23 heures… en théorie. En pratique, beaucoup ne ferment qu’à l’aube…). Les seules limitations sont l’obligation (ici aussi très théorique) du masque dans les transports et magasins, et la limitation à 50% du taux d’occupation des cinémas, musées etc. Par ailleurs la population en grande partie ne suit que très peu les consignes stupides : Le masque est peu porté, ou alors sous le menton. Quand aux « distances sociales »… Voici une photo prise il y a quelques jours dans le métro de Moscou…

La portée de la déclaration de Vladimir Poutine est en fait très politique : Elle montre au clan des globalistes en Russie, mené par le maire de Moscou qui désire renforcer les mesures pour s’aligner sur les pays occidentaux, que son petit jeu est terminé. En août, c’est déjà Vladimir Poutine qui avait ordonné au maire de Moscou de lever la quarantaine (Le maire avait reçu un coup de téléphone en pleine réunion pour préparer l’annonce de la poursuite de la quarantaine et avait déjà commencé à faire envoyer des SMS pour en informer la population. Selon un témoin, le maire n’a rien dit durant 2 à 3 minutes, et à la fin de la communication a déclaré que la quarantaine était levée). La semaine dernière c’est encore le président qui a ordonné au maire de Moscou de cesser l’enseignement « à distance » que celui-ci avait mis en place en octobre pour une grande partie des élèves. Aujourd’hui, le président Poutine déclare donc, au plan national, que les choses ont assez duré.

S’il y a assurément une justification électorale à cette décision, par la chute de popularité du maire de Moscou à 80% de mécontents qui se traduit par la chute de popularité de Poutine avec un énorme 40% de mécontents), il semble clair, alors que les pays occidentaux rivalisent de paranoïa pour savoir qui enfermera le plus durement et longuement sa population, que Vladimir Poutine met la Russie en dehors du plan globaliste. On rappellera par ailleurs les mesures nouvelles que la Russie a inscrites dans sa Constitution (par exemple le mariage = Homme plus Femme exclusivement, la réaffirmation de la foi en Dieu, la prédominance des lois Russes sur les lois internationales, etc) qui montrent clairement le chemin choisi, aux antipodes du projet de société mondialiste.

Le hold-up électoral réalisé par Biden et ses complices aux États-Unis va rapidement entraîner l’Europe de l’Ouest dans une globalisation à marche forcée. Macron a d’ailleurs fait allégeance à Biden lors de leur premier entretien téléphonique hier. La Russie s’affirmera alors comme un oasis souverain dans un monde fou. C’est d’ailleurs pour éviter cela que les globalistes font le forcing avec les tentatives de soulèvement fomentées par la « 5ème colonne » menée par Navalny et quelques oligarques.

Mais, comme le disait ici-même Konstantin Sergueïevitch : « la Russie a les moyens humains, financiers et militaires, de tracer sa voie quelles que soient les réactions des globalistes ». Dans ce même article, Konstantin Sergueïevitch écrit : « Faute de réaction rapide, demain ou après-demain, le pire est déjà programmé ». La déclaration de Vladimir Poutine ce jour sur la fin de la folie autour du covid montre qu’il y a une réaction, qui devrait être suivie d’autres dans les semaines à venir.

source : https://boriskarpov.tvs24.ru

via https://rusreinfo.ru/fr/

Epidémiologie des Eaux Usées

La surveillance des eaux usées pourrait constituer un signal précoce pour aider à la gestion de la pandémie. Actuellement, diverses études ont détecté de l’ARN du SRAS-CoV-2 dans les eaux usées dans le monde entier avec une grande sensibilité, c’est-à-dire quelques jours seulement après l’identification du premier cas humain de Covid-19. La surveillance des eaux usées fournit un échantillon impartial de la population infectée, y compris les individus asymptomatiques.

Résumé à partir de l’article du Dr Bénédicte Helfer publié dans France Soir le 20 octobre 2020 :

http://www.francesoir.fr/societe-sante/le-developpement-de-lepidemiologie-des-eaux-usees-un-nouvel-outil-de-veille-sanitaire

La surveillance des eaux usées pourrait constituer un signal précoce pour aider à la gestion de la pandémie. En effet, outre une prophylaxie efficace en cas de préexposition, ou des traitements thérapeutiques, l’outil le plus important est la capacité d’identifier rapidement les personnes infectées et potentiellement contagieuses. L’anxiété de la population concernant l’augmentation des cas détectés, et l’interprétation qu’il faut en avoir pourraient être résolues par un nouvel outil épidémiologique développé et affiné par des scientifiques de l’environnement au cours des 20 dernières années : L’épidémiologie des eaux usées.

Mise en place dans le cadre du réseau national de surveillance OBEPINE (OBservatoire EPIdémiologique daNs les Eaux usées) qui s’appuie sur 7 équipes de recherche affiliées à 9 tutelles, cette nouvelle approche permettrait de fournir une précieuse aide à la décision des politiques publiques [1, 2]. OBEPINE a ainsi une vocation opérationnelle, (1) soit à l’échelle d’un territoire (selon la taille de la station ; des études ont été réalisées sur l’Ile d’Yeu en Aout par exemple), (2) soit en développant des stratégies d’analyse en remontant les réseaux d’assainissement (développement de capteurs intégrés, analyse dans les collecteurs par quartier, ce qui est fait sous Paris intra muros depuis le printemps). En parallèle de ce réseau national, l’unité COMETE (Covid-19 Marseille Environment Testing & Expertise) initiée par le BMPM (bataillon de marins-pompiers de Marseille) analyse quant à elle les eaux usées collectées sur Marseille.

Cette approche pourrait ainsi venir compléter les différents indicateurs actuellement utilisés pour évaluer le niveau de circulation du virus dans les populations qui sont :

  • Les données cliniques de la maladie qui reste difficile à détecter en raison de signes non-spécifiques le plus souvent.
  • Les tests RT-PCR, couteux, qui posent actuellement des problèmes de sensibilité et spécificité ne permettant pas d’utiliser cet indicateur de façon fiable et robuste [3].
  • L’incidence (nombre de tests positifs sur nombre de tests totaux) qui ne détecte que les cas dans la population testée, et pas dans la population générale
  • Le nombre quotidien de nouvelles hospitalisations, entrées en réanimation et décès

La surveillance des eaux usées a été une stratégie couronnée de succès pour suivre les marqueurs chimiques et biologiques de l’activité humaine [4, 5, 6]. Actuellement, diverses études ont détecté de l’ARN du SRAS-CoV-2 dans les eaux usées dans le monde entier avec une grande sensibilité [7, 8, 9, 10, 11, 12, 13, 14, 15] c’est-à-dire quelques jours seulement après l’identification du premier cas humain de Covid-19 dans un pays [16]. « Depuis le 20 juin, la circulation du SARS-CoV-2 a repris progressivement : on a vu réapparaître des charges virales plus importantes dans les eaux usées, mais à un rythme beaucoup plus lent que lors de la première vague », observe auprès du « Quotidien » le Pr Vincent Maréchal, virologue à Sorbonne Université, initiateur du réseau OBEPINE (consortium de recherche soutenu par le Comité Analyse Recherche et Expertise (CARE) mis en place par le Président Macron qui vise à promouvoir l’analyse des eaux usées pour y détecter d’éventuelles traces de virus SARS-Cov-2 comme outil de surveillance épidémiologique dans le cadre d’un plan de lutte intégrée contre l’épidémie de Covid-19.) Ces résultats démontrent pour la première fois que la quantification du virus permet une analyse fine de la dynamique virale [15].

Cette technique agrège les informations sur la santé au niveau de la totalité de la population. En outre, la surveillance des eaux usées (c’est-à-dire la surveillance des maladies via les effluents humains) fournit un échantillon impartial de la population infectée, y compris les individus asymptomatiques.

Les intérêts de la détection du SARS-CoV-2 dans les eaux usées sont multiples :

  • Approche complémentaire à la surveillance épidémiologique conventionnelle.
  • Diminution de la demande de tests individuels
  • Détection en temps réel de l’évolution de l’épidémie
  • Aide à la décision en matière de politiques publiques sanitaires.
  • Détermination de la population non infectée
  • Surveillance de la variation génotypique du SARS-CoV-2.
  • Renforcement de la transparence et désamorçage des controverses éventuelles.
  • Amélioration des connaissances en termes d’épidémiologie des maladies infectieuses.

La surveillance des eaux usées représente un complément précieux aux approches cliniques. Relativement peu coûteuse et facile à collecter, la surveillance des eaux usées pourrait constituer un signal précoce pour aider à la gestion de la pandémie, et pourrait venir en complément des diagnostics sanitaires individuels [15] y compris dans les pays à faibles revenus.

A Retenir

  • La surveillance des eaux usées permet de détecter précocement de l’ARN du SRAS-CoV-2 dans les eaux usées
  • La surveillance des eaux usées fournit les informations sur la santé de la totalité de la population, indépendante des biais associés à la notification des cas par test individuel RT-PCR.
  • Relativement peu coûteuse et facile à collecter la surveillance des eaux usées pourrait fournir une précieuse aide à la décision des politiques publiques.

Références

[1] http://www.francesoir.fr/societe-sante/le-developpement-de-lepidemiologie-des-eaux-usees-un-nouvel-outil-de-veille-sanitaire

[2] https://youtu.be/ToxeSJcIpcw

[3] https://www.lemediatv.fr/emissions/tout-peut-arriver/tests-covid-19-revelations-sur-un-nouveau-scandale-sanitaire-dEdPMI_qTcuDGwxrmVU7Sw

[4] Sims, Natalie, and Barbara Kasprzyk-Hordern. “Future perspectives of wastewater-based epidemiology: Monitoring infectious disease spread and resistance to the community level.” Environment international vol. 139 (2020),  https://doi.org/10.1016/j.envint.2020.105689

[5] de Oliveira M, Frihling BEF, Velasques J, et al. Pharmaceuticals residues and xenobiotics contaminants: Occurrence, analytical techniques and sustainable alternatives for wastewater treatment. The Science of the Total Environment. (2020);705:135568. https://doi.org/10.1016/j.scitotenv.2019.135568.

[6] Maria Lorenzo, Yolanda Picó, Wastewater-based epidemiology: current status and future prospects, Current Opinion in Environmental Science & Health, Volume 9, (2019), Pages 77-84, https://doi.org/10.1016/j.coesh.2019.05.007.

[7] Ahmed W, Angel N, Edson J, Bibby K, Bivins A, O’Brien JW, Choi PM, Kitajima M, Simpson SL, Li J, Tscharke B, Verhagen R, Smith WJM, Zaugg J, Dierens L, Hugenholtz P, Thomas KV, Mueller JF. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci Total Environ. 2020 august;728:138764. https://doi.org/10.1016/j.scitotenv.2020.138764

[8] Lodder W, de Roda Husman AM. SARS-CoV-2 in wastewater: potential health risk, but also data source. Lancet Gastroenterol Hepatol. 2020 Jun;5(6):533-534. https://doi.org/10.1016/S2468-1253(20)30087-X

[9] Sara Giordana Rimoldi, Fabrizio Stefani, Anna Gigantiello, Stefano Polesello, Francesco Comandatore, Davide Mileto, Mafalda Maresca, Concetta Longobardi, Alessandro Mancon, Francesca Romeri, Cristina Pagani, Francesca Cappelli, Claudio Roscioli, Lorenzo Moja, Maria Rita Gismondo, Franco Salerno, Presence and infectivity of SARS-CoV-2 virus in wastewaters and rivers, Science of The Total Environment, Volume 744, (2020), 140911, https://doi.org/10.1016/j.scitotenv.2020.140911

[10] Fuqing Wu, Jianbo Zhang, Amy Xiao, Xiaoqiong Gu, Wei Lin Lee, Federica Armas, Kathryn Kauffman, William Hanage, Mariana Matus, Newsha Ghaeli, Noriko Endo, Claire Duvallet, Mathilde Poyet, Katya Moniz, Alex D. Washburne, Timothy B. Erickson, Peter R. Chai, Janelle Thompson, Eric, SARS-CoV-2 Titers in Wastewater Are Higher than Expected from Clinically Confirmed Cases,  J. Alm.mSystems Jul 2020, 5 (4) e00614-20; https://doi.org/10.1128/mSystems.00614-20

[11]  A.Nemudryi, A. Nemudraia, T. Wiegand, K. Surya, M. Buyukyoruk, C. Chica, K.K. Vanderwood, R. Wilkinson, B. Wiedenheft, Temporal Detection and Phylogenetic Assessment of SARS-CoV-2 in Municipal Wastewater, Volume 1, ISSUE 6, 100098, September 22, 2020  https://doi.org/10.1016/j.xcrm.2020.100098

[12] Walter Randazzo, Enric Cuevas-Ferrando, Rafael Sanjuán, Pilar Domingo-Calap, Gloria Sánchez, Metropolitan wastewater analysis for COVID-19 epidemiological surveillance, International Journal of Hygiene and Environmental Health, Volume 230, 2020, 113621, https://doi.org/10.1016/j.ijheh.2020.113621

[13] Randazzo, Walter et al. “SARS-CoV-2 RNA in wastewater anticipated COVID-19 occurrence in a low prevalence area.” Water research vol. 181 (2020): 115942. https://doi.org/10.1016/j.watres.2020.115942

[14] Christa Lesté-Lasserre, Coronavirus found in Paris sewage points to early warning system, Science, avr 20, https://www.sciencemag.org/news/2020/04/coronavirus-found-paris-sewage-points-early-warning-system

[15] Sebastien Wurtzer, Vincent Marechal, Jean-Marie Mouchel, Yvon Maday, Remy Teyssou, Elise Richard, Jean Luc Almayrac, Laurent Moulin, Evaluation of lockdown impact on SARS-CoV-2 dynamics through viral genome quantification in Paris wastewaters, medRxiv 2020   https://doi.org/10.1101/2020.04.12.20062679

[16] Gertjan Medema, Leo Heijnen, Goffe Elsinga, Ronald Italiaander, and Anke Brouwer, Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands, Environmental Science & Technology Letters 2020 7 (7), 511-516, https://doi.org/10.1021/acs.estlett.0c00357

Source : https://reinfocovid.fr/science/epidemiologie-des-eaux-usees/

Covid-19 et Sars-Cov-2 – Les preuves d’une fraude globale ?

par M.K. Scarlett.

S’interroger sur le fait de savoir si le Sras-CoV-2 a été ou pas vraiment « isolé » peut sembler pertinent, d’autant que la généticienne Alexandra Henrion-Caude se pose la même question.

L’article qui suit et les informations qu’il contient rend compte de certains faits qui posent question et qui sont par ailleurs peu débattus. Ces éléments ne suffiront sans doute pas à trancher la question, mais ils offrent, considérés dans leur ensemble, des éléments de réponses possibles, qui ouvrent eux-mêmes sur d’autres questionnements. Le tout étant par ailleurs parfois un peu technique, des explications supplémentaires portant sur des détails particuliers seront apportées au lecteur.

Toutefois, et pour mettre les choses en perspective dans le contexte qui est le nôtre aujourd’hui, à savoir que nous avons affaire à des psychopathes — et à des suiveurs autoritaristes souvent corrompus, au rang desquels se trouvent des scientifiques — qui usent de sophisme pour nous raconter une histoire (celle de leur pseudo-réalité), voici un extrait de l’ouvrage de Josef Pieper, Abus de langage, Abus de pouvoir :

« [les sophistes sont des] maîtres dans l’art de déformer les mots, grassement payés et acclamés par les foules […] capables de faire l’éloge d’une chose mauvaise en la faisant apparaître comme bonne et qui [savent] avec maestria transformer le blanc en noir. [la sophistique est] un danger et une menace qui frappent la vie de l’esprit et celle de la société à toutes les époques. […] les sophistes, doués d’une énorme sensibilité pour les nuances du langage et d’une dose extrême d’intelligence formelle, cultivent le mot, érigent et parfaissent l’usage du mot en art — et […] ce faisant, ils corrompent en même temps le sens et la dignité du mot. [Il est essentiel] de reconnaître que quelque chose peut être magnifiquement fait, représenté, mis en scène, filmé brillamment et cependant être en même temps fondamentalement et essentiellement faux, et pas seulement faux, mais aussi mauvais, inférieur, lamentable, honteux, funeste, vil — et pourtant magnifiquement réalisé ! […] la difficulté à reconnaître les sophistes fait partie du succès de ces derniers. »

On retrouve cet abus de langage au sein d’une mauvaise science devenue religieusement universelle dans laquelle il existe

« un phénomène de « corruption systémique », une entreprise de manipulation généralisée permettant de ne pas avoir besoin de soudoyer un grand nombre de personnes. La manipulation globale permet que des foules d’acteurs de bonne foi y participent en toute ignorance de cause. »

Voici donc la traduction de l’article écrit par Iain Davis sur son site Web In This Together.

*

Le Covid-19, et les réponses gouvernementales qui ont suivi, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’aucune preuve n’existe pour démontrer qu’un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis prêt à être corrigé. Cependant, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur comité consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les sondes et les amorces génétiques utilisées dans les tests RT-PCR pour identifier le Sras-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire de même.

D-Salud-Discovery indique qu’il n’existe aucun test capable d’identifier le Sras-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du Covid-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel du Covid-19 est une supercherie. De toute évidence, il n’existe aucun fondement scientifique dans aucune des parties de ce récit.

Si ces affirmations sont exactes, nous pouvons déclarer qu’il n’existe pas de preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est celles des ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Note de MKS

Puisque l’auteur parle de parasites, voici quatre articles qui pourraient permettre au lecteur de creuser un peu plus :

Qu’ont-ils identifié exactement ?

L’Organisation mondiale de la santé (OMS) a classifié la maladie Covid-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de Covid-19 le 11 mars 2020.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le Sras-CoV et le Mers-CoV) par un séquençage de nouvelle génération à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus du Sras-CoV-2 est à l’origine du Covid-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau coronavirus 2019-nCov — Rapport de situation n° 1 », ils déclarent que :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 […] Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques. »

Ces deux déclarations de l’OMS suggèrent clairement que le virus Sras-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les villages aux quatre coins du globe. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause le Covid-19.

Pourtant, l’OMS affirme également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir d’« informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du virus dit Sras-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines en épi [ou protéine Spike – NdT] contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Des virologues affirment qu’il n’est pas possible d’« isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes [et donc in vivo, et non in vitro dans lequel il est sorti de son environnement et ne peut par conséquent pas se comporter de la même manière – NdT]. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries — qui sont des organismes vivants. Par contre, ce que les virologues observent dans des cultures cellulaires, ce sont les effets cytopathogènes du virus qui provoquent la mutation et la dégradation des cellules.

Lorsque les chercheurs chinois ont au départ séquencé le génome complet du Sras-CoV-2, ils ont observé un effet cytopathogène dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire simienne immortalisée et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Note de MKS

Une lignée cellulaire immortalisée est une lignée qui a échappé à la senescence cellulaire (par un procédé chimique) et qui peut donc se diviser indéfiniment in vitro. Les cellules Vero sont une lignée cellulaire utilisée pour les cultures cellulaires. Les cellules Vero E6 sont un clone de la souche 76, elle-même découverte en 1968. La lignée de cellules Vero a été isolée et établie à partir de rein de singe vert adulte d’Afrique (Certopithecus aethiops) en mars 1962 par Y. Yasumura et Y. Kawakita à l’université de Chiba au Japon. Source

Au cœur de l’histoire officielle du Sras-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, [qui serait – NdT] capable de combler le fossé entre les espèces, des animaux aux humains. Lorsque des scientifiques du CDC aux États-Unis ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du Sras-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, y compris les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0), et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules simiennes]… Aucun effet cytopathogène n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules simiennes] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le Sras-CoV-2. »

Le CDC n’a observé aucun effet cytopathogène dans les cellules humaines. Ils n’ont trouvé aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Que le Sras-CoV-2 soit un virus humain capable de provoquer une maladie généralisée est loin d’être évident. Il se peut même qu’il n’existe pas physiquement. Ne serait-ce alors rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Note de MKS

Notez que le Sras-CoV-2 imagé ci-dessus posséderait une protéine de surface (Spike) présentant une différence notable par rapport à d’autres coronavirus génétiquement proches. Ou plus exactement, le site de clivage de la protéine Spike du Sras-CoV-2 posséderait un insert (un fragment de peptide en plus) de quatre acides aminées, absent des protéines Spike de Sras-CoV. Source

À propos de l’origine soi-disant zoonotique, Judy Mikovits a déclaré ce qui suit : […] Il n’a pas pu apparaître de façon naturelle. Le virus n’a pas pu passer directement à l’homme depuis une chauve-souris achetée au marché par un individu. Ça ne fonctionne pas ainsi. Il s’agit d’une évolution virale accélérée. S’il s’agissait d’un phénomène naturel, il faudrait jusqu’à 800 ans pour que le virus évolue de cette manière.

Rappelons aussi que le Dr Pekova suggérait dès avril dernier que le séquençage du Sras-CoV-2 « semble plutôt anormal, et qu’une restructuration aussi importante a peu de chances de se produire dans la nature, sans intervention humaine ».

Voyage de découverte

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le premier génome complet du Sras-CoV-2 (MN908947.1). Ce séquençage a été mis à jour à de nombreuses reprises. Toutefois, MN908947.1 fut le premier à avoir décrit le prétendu agent étiologique du Sras-Cov-2, à savoir le Covid-19.

Toutes les revendications, les tests, les traitements, les statistiques, le développement de vaccins et les politiques qui en découlent sont basés sur ce séquençage. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit du Covid-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du Sras-CoV-2 en faisant correspondre des fragments trouvés dans les échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1 % avec les coronavirus Sras (Sras-Cov). Ils ont utilisé l’assemblage de novo et la PCR ciblée, et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6 % au Sras-CoV.

Ils ont dû utiliser un assemblage de novo parce qu’ils n’avaient aucune connaissance préalable de la séquence ou de l’ordre corrects de ces fragments. En clair, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

Note de MKS

L’assemblage de novo est une technique de séquençage d’un génome inconnu. Il nécessite l’assemblage d’un très grand nombre de petites séquences de ce même génome. Il nécessite aussi un génome de référence (s’il en existe un) afin de positionner (par comparaison) les séquences obtenues. L’assemblage de novo nécessite pour reconstituer un génome complet des programmes bioinformatiques de pointe. Source

Avant de poursuivre, il est nécessaire de comprendre le principe du test PCR et l’usage qui en est fait dans le cadre de la « crise-Covid-19 ».

Il s’agit en tout premier lieu d’un procédé d’amplification moléculaire qui mime le processus naturel de synthèse de l’ADN.

La PCR ciblée est une technique de réplication ciblée in vitro — ou encore ACP pour « amplification en chaîne par polymérase ». Le principe consiste à obtenir, à partir d’un échantillon complexe et peu abondant, d’importantes quantités d’un fragment d’ADN spécifique et de longueur définie, dont l’ordre de grandeur à retenir est celui du million de copies en quelques heures, ce qui est généralement suffisant pour une utilisation ultérieure. Source

Pour Kary Mullis, l’inventeur de la technique PCR qui lui a permis de gagner le prix Nobel de chimie en 1993, cet examen était avant tout qualitatif et destiné à répondre à la question : l’élément est là, oui ou non, mais il n’était pas du tout destiné à le quantifier, et donc, certainement pas conçu pour poser un diagnostic :

« C’est un procédé qui est utilisé pour faire beaucoup de choses à partir de quelque chose. Ça ne dit pas si vous êtes malade. Ça ne dit pas que la chose que vous avez contractée va réellement vous nuire… »

Voir aussi l’avis d’Alexandra-Henrion Caude sur le sujet : « Covid-19, gestion sanitaire, tests PCR, vaccins ARN, stress — Interview avec Alexandra Henrion-Caude ».

Ces cycles d’amplification successifs, peuvent aller, voire dépassent 40. Plus on augmente le nombre de cycles, plus on sera certain de trouver plus de quelque chose, et même une très faible charge virale donnera un résultat positif — à quelque chose qui ressemble à un coronavirus, puisque ces tests détectent des particules virales, des séquences génétiques, mais PAS le virus en entier. Selon Bernard La Scola dans une étude publiée dans la revue European Journal of Clinical Microbiology & Infectious Diseases, « il n’est plus possible de cultiver du virus in vitro lorsque le cycle d’amplification dépasse 34 ». Multiplier ces cycles nécessitent en outre de nombreuses étapes complexes et sujettes à des erreurs, des fautes de stérilité et des contaminations.

Un article pré-publié sur le site medRxiv en juillet 2020 en fait la synthèse :

« Aucune culture virale n’a été obtenue à partir d’échantillons […] avec des cycles d’amplification supérieurs à 24 ou 34, indiquent les chercheurs. La possibilité de cultiver du virus décroit lorsque les cycles d’amplification augmentent. »

Par ailleurs, et histoire de rajouter à la confusion, le nombre de cycles n’est pas le même d’un pays l’autre, voire d’un laboratoire à l’autre au sein d’un même pays…

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome déjà connu et publié du coronavirus du Sras (Sras-CoV). Malheureusement, la précision du génome original du coronavirus du Sras n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié cinquante patients atteints du syndrome respiratoire aigu sévère (Sras). Ils ont prélevé des échantillons sur deux de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

À partir du matériel génétique trouvé, ils ont créé trente clones. Tandis qu’ils n’ont pu trouver aucune preuve d’un autre virus connu, ils ont toutefois trouvé dans un seul de ces échantillons clonés des séquences génétiques d’« origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57 % de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggéraient la découverte d’un nouveau virus du Sras-CoV (toute nouvelle découverte étant par ailleurs considérée par les scientifiques comme une ambroisie), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour détecter le nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du Sras, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie. »

Note de MKS

Bien que l’auteur l’aborde partiellement plus loin, il est utile d’expliquer rapidement ce qu’est une « amorce » (et une sonde) dans le langage de la recherche génétique, voyons les quatre étapes du test PCR (après le prélèvement).

  • La première étape est celle de la dénaturation réalisée à une température de 95°C, l’ADN double-brin est séparé en ses deux brins d’ADN constitutifs ;
  • La deuxième étape est celle de l’hybridation lors de laquelle un oligonucléotide (la sonde) s’apparie à la séquence d’ADN qui lui est complémentaire ;
  • La troisième étape est celle de la polymérisation dans laquelle un deuxième oligonucléotide, l’amorce, s’hybride en amont, à quelques paires de bases de distance de la sonde ;
  • La quatrième étape est celle de l’émission de fluorescence qui permet d’éventuellement détecter et quantifier un signal fluorescent à même de prouver la présence de ce qui est recherché.

Pour plus de détails, consultez cet article assez simplifié d’où j’ai tiré ce qui précède, ou celui-ci, bien plus fourni. Selon eurofins, les étapes 1 à 4 sont répétées de 35 à 50 fois. Un must !

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs à ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus Sras-CoV. La question n’a pas été posée.

Ce supposé virus ne présentait qu’une correspondance de séquence de 57 % avec un coronavirus prétendument connu. Les 43 % restants étaient juste « là ». Les données séquencées ont été produites et enregistrées en tant que nouveau génome auprès de la GenBank sous le numéro d’accès AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une séquence correspondant à 79,6 % à AY274119 et l’ont donc qualifiée de nouvelle souche de Sras-CoV (2019-nCoV — finalement rebaptisée Sras-CoV-2). Personne n’avait, à aucun moment de ce processus, produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Ils n’ont rien isolé

Les scientifiques sont très agacés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. La raison en est que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus Sras-CoV-2. Ce dont nous disposons, en revanche, c’est d’un génome complet et, comme nous sommes sur le point de le découvrir, celui-ci n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du Sras-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

Note de MKS

En préambule des réponses retranscrites ci-dessous, les auteurs de l’article stipule ce qui suit :

« Et comme les tests PCR sont calibrés pour les séquences de gènes (dans ce cas-ci les séquences d’ARN car on pense que le Sras-CoV-2 est un virus à ARN), nous devons savoir que ces extraits de gènes font partie du virus recherché. Et pour le savoir, il faut procéder à une isolation et une purification correctes du virus présumé.

C’est pourquoi nous avons demandé aux équipes scientifiques [auteurs] des documents pertinents auxquels il est fait référence dans le contexte du Sras-CoV-2 de prouver si les clichés au microscope électronique présentés dans leurs expériences in vitro montrent des virus purifiés. »

Voici les réponses de ces scientifiques :

Study 1: Leo L. M. Poon; Malik Peiris. « Emergence of a novel human coronavirus threatening human health » Nature Medicine, March 2020
Replying Author: Malik Peiris
Date: May 12, 2020
Answer: « The image is the virus budding from an infected cell. It is not purified virus. » [L’image est le virus bourgeonnant d’une cellule infectée. Ce n’est pas un virus purifié.]

Study 2: Myung-Guk Han et al. « Identification of Coronavirus Isolated from a Patient in Korea with COVID-19 », Osong Public Health and Research Perspectives, February 2020
Replying Author: Myung-Guk Han
Date: May 6, 2020
Answer: « We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells. » [Nous n’avons pas pu estimer le degré de purification car nous ne purifions pas et ne concentrons pas le virus cultivé dans les cellules.]

Study 3: Wan Beom Park et al. « Virus Isolation from the First Patient with SARS-CoV-2 in Korea », Journal of Korean Medical Science, February 24, 2020
Replying Author: Wan Beom Park
Date: March 19, 2020
Answer: « We did not obtain an electron micrograph showing the degree of purification. » [Nous n’avons pas obtenu de micrographie électronique montrant le degré de purification.]

Study 4: Na Zhu et al., « A Novel Coronavirus from Patients with Pneumonia in China », 2019, New England Journal of Medicine, February 20, 2020
Replying Author: Wenjie Tan
Date: March 18, 2020
Answer: « [We show] an image of sedimented virus particles, not purified ones. » [[Nous montrons] une image de particules de virus sédimentées, et non pas purifiées.]

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus Sras-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré [le 29 janvier 2020] :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic. »

Ceci explique pourquoi le gouvernement australien a déclaré [le 4 décembre 2020] :

« La fiabilité des tests Covid-19 est incertaine en raison de la base de preuves limitée… Il existe peu de preuves disponibles pour évaluer la précision et l’utilité clinique des tests Covid-19 disponibles. »

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus Covid-19 a été isolé. »

Ils n’ont, à ce jour, pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a présenté aux autorités nationales en charge de la santé publique en Angleterre [PHE en anglais – NdT] une requête en vertu de la loi sur la liberté de l’information. Il leur a demandé de lui fournir leurs dossiers décrivant la façon dont le virus du Sras-COV-2 avait été isolé. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande. »

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande. »

Aux États-Unis, le Panel de diagnostic RT-PCR du Centre de contrôle des maladies (CDC) indique ce qui suit :

« […] Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible […] La détection de l’ARN viral pourrait ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques. »

Dans leur dernière mise à jour du 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de Covid-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le Sras-CoV-2 est présent ou cause le Covid-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons nous contenter d’images de choses dont nous savons qu’elles pourraient être autre chose et de séquences génétiques (qui pourraient être n’importe quoi d’autre) comme autant de preuves concluantes que ce virus, et la maladie qu’il est censé causer, sont réels.

Tester en vain

L’OMS, ainsi que tous les gouvernements, les think-thank, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel du Covid-19, affirment que le Sras-CoV-2 provoque le Covid-19. Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du Sras-CoV-2 a été publié. Il relève du domaine public.

Au sein du génome du Sras-CoV-2, des séquences génétiques clés auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment des quatre suivantes :

  • Le gène de l’ARN polymérase ARN-dépendante (Rd-Rp) — Il permet à l’ARN du Sras-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales malades du Covid-19 ;
  • Le gène S (ORF2) — Cette glycoprotéine forme le pic [Spike – NdT] à la surface du virion du Sras-CoV-2 qui est censé faciliter la liaison du Sras-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée ;
  • Le gène E (ORF1ab) — C’est une petite protéine membranaire utilisée dans l’assemblage du virus ;
  • Le gène N (ORF9a) — Il s’agit du gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre accessible au public des amorces et des sondes RT-PCR utilisées pour tester le Sras-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins anti-sens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral présumé. Au cours de l’amplification, alors que les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est de l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du Sras-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST) [il s’agit d’une méthode de recherche heuristique utilisée en bioinformatique. Le BLAST permet de trouver les régions similaires entre deux ou plusieurs séquences de nucléotides ou d’acides aminés, et de réaliser un alignement de ces régions homologues – NdT]. Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc « BLASTER » [rechercher] les amorces, les sondes et les séquences de gènes cibles qui ont été déclarées dans la recherche du Sras-CoV-2.

Les amorces et les protocoles de sonde de l’OMS pour le génome viral présumé du Sras-CoV-2 sont basés sur les profils des gènes Rd-Rp, ORF1, N et E. N’importe qui peut les soumettre à l’analyse de BLAST et découvrir les résultats.

La séquence nucléotidique vitale Rd-RP, utilisée comme amorce avant, est — ATGAGCTTAGTCCTGTTG. Si nous lançons une recherche nucléotidique sur BLAST, celle-ci est enregistrée comme correspondant à l’isolation complète du Sras-CoV-2 avec une identité de séquence identique à 100 %. De même, la séquence d’amorce du gène E inverse — ATATTGCAGCAGTACGCACACA — révèle la présence de la séquence ORF1ab qui identifie également le Sras-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence Rd-Rp du Sras-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100 %. La recherche sur le ORF1ab (gène E) en trouve 90 avec une identité de séquence de 100 % avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes dont la séquence correspond à 100 % au gène du Sras-CoV-2 E, et 100 microbes dont la séquence correspond à 100 % au gène vital Rd-Rp du Sras-CoV-2 .

Chaque fois que nous vérifions les soi-disant marqueurs génétiques uniques au Sras-CoV-2 qui sont enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le Sras-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, depuis des séquences microbiennes jusqu’à des fragments de chromosomes humains.

Les soi-disant vérificateurs-de-faits (fact-checkers), comme le projet Health Feedback de Reuters, se sont empressés de rejeter les revendications de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du Sras-CoV-2. Ils utilisent une ribambelle d’arguments bidons comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), ce qui fait que leur tentative de démystification aboutit à quelque chose comme ça :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus Sras-CoV-2. De plus, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence d’ADNc entre les amorces est unique au virus. »

Cette façon de faire semble déformer de manière délibérée la portée des observations émises en amont en avançant un argument que personne, à part les vérificateurs-de-faits eux-mêmes, ne fait valoir. Les recherches effectuées sur BLAST montrent que ces séquences cibles ne sont pas uniques au Sras-CoV-2. Pas plus qu’il n’est nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont enquêté sur l’épidémiologie des cas marocains présumés du Sras-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs à aucun.

Ceci est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (TAAN) avec au moins deux cibles indépendantes du génome du Sras-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé […] Un ou plusieurs résultats négatifs n’excluent pas nécessairement une infection par le Sras-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs-de-faits grassement rémunérés, si les amorces avant et arrière identifient des débris, l’une identifiant peut-être le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée située entre elles est probablement aussi un débris.

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que dans le prétendu génome du Sras-CoV-2 l’entièreté des chromosomes ou des microbes sont séquencés. Même s’il est possible que ce soit effectivement le cas, pour ce que l’on en sait. Ce qui est avancé [par ceux qui interroge les méthodes de dépistage – NdT], c’est que les prétendus marqueurs utilisés pour tester ce supposé virus ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des occurrences de fluorescence de sondes spécifiques pour indiquer la présence de séquences supposées exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « poubelle » (ADNc).

Note de MKS

À propos de l’ADN « poubelle », voir cet article du Dr Gaby : « L’ADN « poubelle » viral, le régime cétogène qui améliore l’ADN et les effets cométaires ».

Par exemple, le gène S du Sras-CoV-2 est censé être hautement spécifique au génome du virus du Sras-CoV-2. La séquence cible est — TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100 %. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95 %. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100 % avec 86 fragments de chromosomes humains.

Quel que soit l’endroit où l’on regarde dans le supposé génome du Sras-CoV-2, rien dans les protocoles de test de l’OMS ne permet d’identifier clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du Sras-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas — et puisqu’il n’y a pas d’isolats ou d’échantillons purifiés du virus — aucune preuve de l’existence du Sras-CoV-2 sans test viable ne peut exister. Par conséquent, il n’existe pas non plus de preuve de l’existence d’une maladie appelée Covid-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de Covid-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Note de MKS

Sur rien de « scientifique », mais sur une nécessité psychopathique servie par une certaine science, sans aucun doute.

Fraude et conspiration

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre. »

La définition juridique d’une conspiration est la suivante

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel. »

Il semblerait que ceux qui prétendent que nous sommes confrontés à une « pandémie » n’aient fourni aucune preuve montrant qu’un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Toutes les informations suggérant fortement qu’une telle probabilité existe sont facilement accessibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations à des fins frauduleuses, il s’agit alors d’une conspiration (dans les pays qui appliquent la Common law) ou d’une entreprise criminelle commune en vertu du Droit international.

Note de MKS

La Common law est système juridique anglo-saxon dont les règles sont principalement édictées par les tribunaux au fur et à mesure des décisions individuelles, et non sur le Droit civil comme en France qui s’appuie sur le Droit codifié — encore que la France fait de plus en plus souvent fi du Droit codifié pour le remplacer par la Common law, dont la jurisprudence a toujours été l’élément fondamental. Généralement, les pays sous la Common law sont les anciennes colonies ou les anciens protectorats britanniques y compris les Etats-Unis (à la seule exception de la Louisiane où s’applique un droit codifié.)

Il semble que le Covid-19 ait été délibérément utilisé comme casus belli pour mener une guerre contre l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de flâner a été restreinte, la liberté de parole et d’expression a été érodée, les droits de manifester ont été réduits, nous avons été séparés de nos proches, et nos sociétés ont été détruites, soumises à des assauts psychologiques, muselées et terrorisées.

Le Prince Charles nous demande d’accueillir la Grande réinitialisation à bras ouverts

Pire encore, alors qu’il n’existe pas de preuve d’une mortalité sans précédent toutes causes confondues, on a enregistré des pics de mortalité anormaux. Ces pics correspondent précisément aux mesures de « confinement » qui ont entraîné une interruption des soins de santé primaires et une réorientation des services de santé publique financés par nos impôts pour traiter à l’exclusion de toutes les autres une prétendue maladie.

En outre, ceux qui ont présenté et fait circuler le récit Covid-19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à leur soi-disant « nouvelle normalité » [ou nouvelle réalité, soit leur pseudo-réalité – NdT], à savoir la transformation complète sans notre consentement de toute notre société, ils exigent que nous nous soumettions à leurs conditions.

Ces mesures comprennent, sans s’y limiter, une surveillance biométrique de chacun, un contrôle et un suivi centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives, jusqu’à celle qui exige clairement que nous renoncions à toute forme de souveraineté sur nos propres corps. Toutes ces mesures constituent les conditions qui prévalent dans l’esclavage.

Il ne fait aucun doute que nos droits ont été bafoués et que nous en avons été dépouillés. Dans les pays qui exercent la Common law, l’innocence est présumée, mais il n’empêche que les preuves d’un préjudice délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, émanent clairement de think tanks mondialistes et d’institutions supranationales, et ont été élaborées bien avant l’émergence de cette soi-disant pandémie.

Dans les pays soumis au Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils faudrait qu’ils puissent prouver que, en dépit de leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le Covid-19 est un mythe.

Note de MKS

Le Code Napoléon est aussi appelé Code civil, et la présomption d’innocence est le principe selon lequel toute personne, qui se voit reprocher une infraction, est réputée innocente tant que sa culpabilité n’a pas été légalement démontrée. La plupart des pays d’Europe reconnaissent et utilisent le principe de la présomption d’innocence selon l’article 6 de la Convention européenne des droits de l’homme. Toutefois, il est des cas, tout du moins en France, où la présomption de culpabilité existe en vertu des exceptions au droit à la présomption d’innocence. Ces exceptions sont légales et la charge de la preuve de la non-culpabilité repose alors sur le prévenu.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source de l’article initialement publié en anglais le 16 novembre 2020 : In This Together

traduit par Sott.net

*

Alors, fraude totale ou partielle ?

Si l’on part du principe, comme postulé ici, que le Sras-Cov-2 est d’origine humaine, et qu’il est donc « réel », faut-il donc en déduire que le séquençage qui en a été fait est faux, bidouillé, falsifié, suffisamment pour en cacher certains éléments, parmi ceux qui pourraient servir les psychopathes au pouvoir, mais pas assez pour en révéler certains aspects ? Encore que les éléments de preuve développés dans « Les preuves irréfutables de l’origine humaine du Sras-Cov-2 » proposent justement d’y répondre :

« Nous avons tout au long de cet article examiné les preuves suggérant que le Sras-Cov-2 a été fabriqué à Fort Detrick et qu’il a été incorporé dans un vaccin dans le but explicite de se propager à grande échelle et d’affecter les fonctions neurologiques associées à l’obéissance.

Il semble que ce projet ait toutefois échoué, d’abord parce que le « virus de l’obéissance » a muté en un « virus de la désobéissance », ce qui a contraint les pouvoirs publics à prendre — à tout prix — des mesures hâtives en vue de limiter la propagation du mutant bénéfique.

Le confinement général fut une tentative désespérée de minimiser la propagation des effets potentiellement bénéfiques de la mutation du Sras-Cov-2. »

Au départ, il y a une fabrication. Puis s’en est suivi une mutation. Le séquençage « officiel » du Sras-Cov-2 correspond-il au virus initial ou à sa mutation ? Ou à un autre « état » intermédiaire ?

Quoiqu’il en soit, c’est une question à laquelle il est pour le moment difficile de répondre, et il est possible que nous n’en saurons jamais rien. Nous avons plus que certainement des lacunes tant techniques que factuelles pour comprendre les tenants (mais pas les aboutissants) de tout ceci. Tout ce que nous savons, à ce stade, c’est que ce virus est utilisé pour tenter d’imposer aux populations terrorisées un monde dystopique — par le biais notamment d’un programme économique et politique totalitaire qui se propose d’avancer des conjectures et des théories malsaines sur ce à quoi le monde post-soi-disant-pandémique devrait ressembler.

« Faites-vous vacciner pour protéger les autres ! » « Pas de vaccin = pas de travail, pas de shopping, pas de voyage, pas de socialisation ! ». En gros, vous êtes libre de choisir entre le passeport d’immunité ou une peine de prison à vie dans une cellule isolée.

Pour conclure, qu’est-ce que la « science » ? Selon Nissim Amzallag :

« La science ne distille pas forcément le vrai, cela nous le savons depuis le début du XXe siècle. Et pourtant, une aura d’objectivité continue de protéger la science de toute critique non seulement sur ses fondements, mais encore sur la manière dont elle s’impose pour façonner la société. »

L’auteur dans son ouvrage La réforme du vrai — Enquête sur les sources de la modernité, publié en 2010 aux Éditions Charles Léopold Mayer, « explore les fondements sur lesquels s’est appuyée la révolution scientifique et les métamorphoses qu’elle a induites dans la société. » Nissim Amzallag plonge dans des considérations historiques pour essayer de comprendre si la science naissante, dite moderne depuis la pomme de Newton (mythe fondateur, s’il en est), « fut réellement motivée par un désir sincère d’intelligence du réel ». C’est loin d’être le cas :

« les innovations les plus importantes, conceptuelles comme pratiques, dérivent de parti pris étrangers à toute exigence du réel ».

Son livre s’adresse à tous ceux qui souhaitent s’émanciper « de l’autorité d’une idéologie maquillée en savoir » en prenant conscience de l’existence d’une réforme du vrai. Ou devrait-on l’appeler « réforme du réel » ? En effet, il est difficile, quand on les connaît toutes les deux, de ne pas faire le lien entre l’existence des pseudo-réalités psychopathiques et la réforme du vrai de l’auteur, une réforme qui permet justement la mise en place de la dite pseudo-réalité. Dans son ouvrage, il en aborde en 2010 toutes les étapes sauf celle, finale, mais vouée à l’échec de par sa nature utopique, que nous expérimentons aujourd’hui.

source : https://fr.sott.net/article
via : https://reseauinternational.net/covid-19-et-sras-cov-2-les-preuves-dune-fraude-globale/

Céline et la soumission imbécile du Français

par Nicolas Bonnal.

On entend ici et là qu’on va réagir, qu’on est le pays des rebelles, des droits de l’homme, de la liberté, des tranchées et qu’on va voir ce qu’on va voir à propos du vaccin, du masque, du confinement.

Je répète : jouez aux rebelles quinze secondes, vous qui me jetez la pierre, dans le métro, à l’école, au boulot. Il n’y a pas 30% de mécontents ou d’insoumis dans ce pays, mais 1%. Et ça dépend des jours et du sujet

Une amie m’a écrit hier :

« J’entendais hier un général de gendarmerie, étonné de la « docilité » des Français (à propos du couvre-feu), qui disait qu’en réalité on n’aurait pas le choix. Carnet vaccinal obligatoire pour voyager ; pour se soigner et aller à l’hosto idem ; pour travailler encore, les administrations demanderont à leurs employés de se faire vacciner (et je doute que le privé soit en reste) ; bref ce que tu dis depuis des mois ».

C’est ce que je dis depuis des mois parce que c’est ce qui se passe depuis des siècles.

Tout pays de la liberté se croit plus libre au fur et à mesure qu’il s’enferme dans les réseaux inextricables des lois. Maistre rappelait en 1789 qu’on avait eu plus de lois en un an qu’en mille.

Quelques rappels céliniens alors. C’est ma monographie la plus lue – avec celle de Tolkien – et elle est lue par des gens qui ont compris que Céline ne parle pas des juifs (sujet éculé tout de même) mais des Français :

« Il règne sur tout ce pays, au tréfonds de toute cette viande muselée, un sentiment de gentillesse sacrificielle, de soumission, aux pires boucheries, de fatalisme aux abattoirs, extraordinairement dégueulasse. Qui mijote, sème, propage, fricote, je vous le demande, magnifie, pontifie, virulise, sacremente cette saloperie suicidaire ? Ne cherchez pas ! Nos farceurs gueulards imposteurs Patriotes, notre racket nationaliste, nos chacals provocateurs, nos larrons maçons, internationalistes, salonneux, communistes, patriotes à tout vendre, tout mentir, tout provoquer, tout fourguer, transitaires en toutes viandes, maquereaux pour toutes catastrophes. Patriotes pour cimetières fructueux. Des vrais petits scorpions apocalyptiques qui ne reluisent qu’à nous faire crever, à nous fricoter toujours de nouveaux Déluges ».

Céline a compris que le Français n’est pas une victime de Macron, Hollande ou Sarkozy, du comité des forges ou du mondialisme ou de Bruxelles : le Français est un enthousiaste. On le laisse cracher le morceau (à Céline) :

« Plus de Loges que jamais en coulisse, et plus actives que jamais. Tout ça plus décidé que jamais à ne jamais céder un pouce de ses Fermes, de ses Privilèges de traite des blancs par guerre et paix jusqu’au dernier soubresaut du dernier paumé d’indigène. Et les Français sont bien contents, parfaitement d’accord, enthousiastes ».

Cela c’était avant 39. Pour aujourd’hui aussi ces lignes résonnent furieusement (pensez à ces queues d’andouilles voulant être testées cet été…) :

« Une telle connerie dépasse l’homme. Une hébétude si fantastique démasque un instinct de mort, une pesanteur au charnier, une perversion mutilante que rien ne saurait expliquer sinon que les temps sont venus, que le Diable nous appréhende, que le Destin s’accomplit ».

Certains nous font le coup à la mode Maurras du grand recours, de la divine surprise (Trump…). On a vu la lâcheté incisive des femmes Le Pen. Céline savait ce qu’il en coûtait de se fier aux patriotes, aux nationalistes et autres, toujours les premiers à offrir leur poitrine aux démocraties, comme disait Bernanos. Et de rentrer dedans :

« Dans nos démocraties larbines, ça n’existe plus les chefs patriotes. En lieu et place c’est des effrontés imposteurs, tambourineurs prometteurs « d’avantages », de petites et grandes jouissances, des maquereaux « d’avantages ». Ils hypnotisent la horde des « désirants », aspirants effrénés, bulleux « d’avantages ». Pour l’adoption d’un parti, d’un programme, c’est comme pour le choix d’un article au moment des « réclames », on se décide pour le magasin qui vous promet le plus « d’avantages ». Je connais moi des personnes, des véritables affranchis qui sont en même temps marxistes, croix-de-feu, francs-maçons, syndiqués très unitaires et puis malgré tout, quand même, encore partisans du curé, qui font communier leurs enfants. C’est des camarades raisonnables, pas des fous, qui veulent perdre dans aucun tableau, qui se défendent à la martingale, des Idéologues de Loterie, très spécifiquement français. Quand ça devient des racailles pareilles y a plus besoin de se gêner ».

Cela s’applique aussi au Bayrou, catho, bourgeois, six enfants, qui nous prépare le passeport vaccinal et la grande confiscation dans un bâillement/acquiescement général.

Céline remet notre occident démocrate – qui retombe dans son terrorisme/bolchévisme initial, ici ou en Amérique – à sa place :

« La conjuration mondiale seule véritable réussite de notre civilisation. Nous n’avons plus de patriotes. C’est un regret de bétail, on en a presque jamais eu de patriotes. On nous a jamais laissé le temps. D’une trahison dans une autre, on a jamais eu le temps de souffler… D’une guerre dans une autre… »

Après on est vendus aux étrangers mais c’est depuis des siècles (pensez à Concini dans le Capitan…) :

« On nous a toujours trafiqués, vendus comme des porcs, comme des chiens, à quelque pouvoir hostile pour les besoins d’une politique absolument étrangère, toujours désastreuse. Nos maîtres ont toujours été, à part très rares exceptions, à la merci des étrangers. Jamais vraiment des chefs nationaux, toujours plus ou moins maçons, jésuites, papistes, juifs… »

Parti de l’ordre, parti catholique, parti social-démocrate, parti européen, parti pro-américain, parti prosoviétique, on n’en finirait pas… Comme on sait dans le dernier pamphlet Céline a compris que le problème français est insoluble, plus fort que prévu, et que « bouffer du juif ne suffit plus » ! Il était temps Ferdinand !

Qui a envie de bouffer du Zemmour, du Toubiana, du Kunstler, du Greenwald ? En pourcentage il y a plus de juifs que de goys antisystèmes. 10% dans un cas, un pour dix mille dans l’autre.

Un autre antisémite qui a enfin compris les Français c’est Drumont. Et dans son Testament, très supérieur à la France juive, il écrivait le vieil Édouard :

« Quand les conquérants germains et francs qui, unis aux purs Gaulois et aux Celtes, constituèrent véritablement la France eurent perdu leur vigueur, l’élément gallo-romain l’emporta, la race latine reprit le dessus ; or, cette race est faite pour la tyrannie, puisqu’elle n’a aucun ressort de conscience ; elle adore une idole imbécile, une idole de marbre ou de plâtre qu’on appelle la Loi, et au nom de cette Loi, elle subit tout ».

Ensuite Drumont l’explique cette ludique loi gallo-romaine :

« La Loi, c’est le licteur qui vient de la part de César annoncer au citoyen romain qu’il est condamné à mourir, mais qu’on lui laisse le choix du supplice ; c’est le gendarme de la Révolution qui vient parfois tout seul arrêter cinq ou six personnes et qui les conduit au Luxembourg ou à la Conciergerie, où un autre gendarme vient les chercher pour les conduire à la guillotine. Jamais il n’est entré dans la cervelle de ceux qu’on arrêtait ainsi, l’idée de commencer par tuer le gendarme. C’est là un spectacle extraordinaire et il n’y a jamais qu’en France qu’un gouvernement ait pu s’appeler, comme par une désignation constitutionnelle: la Terreur ».

Revenons à Céline et à la docilité du colonel de gendarmerie cité plus haut :

« Les Français subiront leur sort, ils seront mis, un jour, à la sauce vinasse… Ils le sont déjà. Pas d’erreur !… Le conquérant doit être sûr de ses esclaves en tous lieux, toujours en mains, sordidement soumis, il doit être certain de pouvoir les lancer, au jour choisi, parfaitement hébétés… dociles… jusqu’ aux os… gâteux de servitude, dans les plus ronflants, rugissants fours à viande… sans que jamais ils regimbent, sans qu’un seul poil de ce troupeau ne se dresse d’hésitation, sans qu’il s’échappe de cette horde le plus furtif soupçon de plainte… »

C’est lui qui qualifie nos monuments aux morts de lourds dolmens de la docilité…

________

sources : Nicolas Bonnal – Céline, Le pacifiste enragé

13 des actes de désobéissance civile les plus mémorables de l’histoire

Résister aux tyrans, c’est obéir à Dieu. – Rev. Jonathan Mayhew (1720-1766)

Depuis le début de la civilisation, l’humanité a été confrontée à des problèmes tels que l’inégalité et l’injustice. Les victimes de ces problèmes exigent que leurs droits soient respectés, mais sans pouvoir exercer une influence substantielle, leurs demandes restent sans réponse. En 1849, le philosophe américain Thoreau a publié “In Resistance to Civil Government”, un essai dans lequel il présente une méthode permettant au peuple de mettre en place des changements dans le gouvernement.

C’est Henry David Thoreau, qui a posé la célèbre question suivante : “Le citoyen doit-il jamais, ne serait-ce qu’un instant, ou au moins dans une certaine mesure, renoncer à sa conscience face au législateur ? Pourquoi chaque homme a-t-il alors une conscience ? Je pense que nous devrions être des hommes d’abord, et des sujets ensuite.”

Si le choix est l’obéissance ou la conscience, je fais de mon mieux pour choisir la conscience.

Historiquement, la désobéissance civile – le refus de se conformer à une loi ou à un ordre d’une autorité politique – est extrêmement courante. Parfois, elle est silencieuse et passe largement inaperçue. D’autres fois, elle est bruyante et publique.

Défier un pharaon dans l’Égypte ancienne

Le premier chapitre du Livre de l’Exode de l’Ancien Testament fournit ce qui est probablement le plus ancien exemple enregistré de désobéissance civile. Il date d’environ 3 500 ans.

Deux sages-femmes en Égypte, nommées Shiphrah et Puah, ont désobéi à un ordre du Pharaon de tuer tous les bébés mâles hébreux à la naissance. Lorsqu’elles ont été appelées à rendre des comptes, elles ont menti pour couvrir leurs traces. Le récit de l’Exode dit que leur défiance a plu à Dieu, qui les a récompensés pour cela.

Ainsi, quiconque dit que Dieu est toujours du côté des politiciens doit lutter contre cet exemple, ainsi que le suivant.

La représentation d’Antigone par Sophocle

Le dramaturge Sophocle a écrit de nombreuses tragédies littéraires, dont l’une (bien que fictive) raconte l’histoire d’Antigone. Créon, le roi de Thèbes, tente de l’empêcher d’offrir à son frère Polynies un enterrement digne de ce nom.

Antigone a déclaré que sa conscience était plus importante que tout décret royal. Elle est condamnée à mort pour avoir défié la loi, mais ne se rétracte jamais.

La Judée et le massacre d’innocents

Le livre de Matthieu dans le Nouveau Testament révèle que lorsqu’il a appris qu’un Messie juif était né à Bethléem, le roi Hérode s’est senti personnellement menacé. Il a ordonné aux Mages (les trois sages en visite) d’aller à la ville, de trouver le bébé, puis de lui faire un rapport.

Comme nous le savons tous, les Mages se sont effectivement rendus à Bethléem où ils ont offert des cadeaux à Joseph, Marie et à l’enfant Jésus, mais ils ont ensuite désobéi à Hérode et ont disparu.

Dans un accès de colère, le roi a alors ordonné l’exécution de tous les enfants mâles de moins de deux ans dans les environs de Bethléem. Si Joseph et Marie et les autres personnes qui les ont aidés n’avaient pas refusé d’obtempérer, l’histoire du christianisme serait bien différente.

Robert le Bruce défie un pape

En 1317, le pape a demandé au roi Robert Ier d’Écosse (plus connu sous le nom de Robert le Bruce) d’accepter une trêve avec les Anglais lors de la première guerre d’indépendance de l’Écosse. En raison de son refus de suivre les ordres du pape, Robert fut excommunié.

En 1320, les nobles écossais ont porté le défi de leur roi à un niveau supérieur dans une lettre connue sous le nom de Déclaration d’Arbroath. C’était la première fois dans l’histoire qu’un groupe organisé de personnes affirmait qu’il était du devoir d’un roi de gouverner avec le consentement des gouvernés et du devoir des gouvernés de se débarrasser de lui s’il ne le faisait pas.

“Ce n’est pas pour les honneurs, la gloire ou la richesse que nous nous battons”, déclaraient-ils, “mais uniquement pour la liberté, à laquelle aucun homme de bien n’abandonne, si ce n’est avec sa vie”. Voir Sept siècles depuis William Wallace.

La position de Flushing pour les Quakers

Le gouverneur Peter Stuyvesant des colonies néerlandaises en Amérique du Nord n’aimait pas les quakers. En 1656, il a commencé à les persécuter et a exigé la participation des autorités locales. L’année suivante, les citoyens de Flushing (aujourd’hui Queens, New York City) rédigent et signent un document connu sous le nom de “Flushing Remonstrance”.

Comme je l’ai écrit récemment, ces braves gens ont essentiellement dit à Stuyvesant : “Vous nous commandez de persécuter les Quakers. Nous ne le ferons pas. Alors prenez votre intolérance et mettez-la là où le soleil ne brille pas”.

Le gouverneur a fermé le conseil municipal de Flushing et a arrêté certains des signataires du document, mais la Compagnie des Indes occidentales néerlandaises lui a finalement ordonné d’annuler sa politique de persécution.

La Smashing Tea Party de Boston

Personne ne prend le thé comme les colons mécontents de Beantown. En 1773, le Parlement britannique a conféré à la Compagnie britannique des Indes orientales un monopole commercial sur le commerce du thé. Cela, ainsi que la “taxation sans représentation”, a incité les Fils de la Liberté à organiser le célèbre Boston Tea Party, un événement organisé par Samuel Adams et d’autres patriotes américains.

Sous le couvert de la nuit, les colons montèrent à bord d’un navire britannique et jetèrent sa cargaison de thé dans le port de Boston. Trois ans plus tard, la désobéissance civile a évolué en une Déclaration d’indépendance et une guerre ouverte entre la Grande-Bretagne et ses colonies américaines.

Prohibition : Partout, États-Unis

De 1920 à 1933, l’Amérique s’est engagée dans une croisade nationale contre l’importation, la fabrication, le transport et la vente de boissons alcoolisées, connue sous le nom de Prohibition.

Les gens buvaient quand même.

Les femmes, qui auparavant n’apparaissaient presque jamais dans les bars, s’abreuvent maintenant dans les bars clandestins et les ruelles de tout le pays. Les hommes construisaient leurs propres alambics illégaux et se tiraient dessus pour gagner des parts de marché. Le taux de criminalité est monté en flèche. Les jurys refusaient souvent de condamner des délinquants évidents, et au moins un jury a bu les preuves avant de déclarer l’accusé innocent.

Lorsque Woodrow Wilson quitta la Maison Blanche en janvier 1921, il emporta sa réserve d’alcool avec lui. Son successeur, Warren Harding, en a apporté une autre.

Au moment où tout cela fut aboli, les gens avaient vraiment besoin de cette bonne boisson bien raide qu’ils consommaient depuis le début. (Voir Les ennemis de la prohibition).

La célèbre marche du sel de Gandhi

En Inde, sous domination britannique, les entreprises britanniques jouissaient de privilèges de monopole. En 1882, la loi sur le sel a interdit aux Indiens de collecter ou de vendre le sel, un aliment de base.

Le ressentiment contre la loi et la domination britannique en général a finalement donné lieu à la célèbre Marche du sel de Mohandas Gandhi en 1930. Un grand nombre d’Indiens ont suivi Gandhi dans une manifestation pacifique sur une distance de 240 miles jusqu’à la mer d’Arabie.

Plus de 55 000 personnes ont été arrêtées, mais l’Inde a finalement obtenu son indépendance en 1947.

La “révolution chantante” de l’Europe de l’Est

C’est peut-être difficile à croire, mais le chant a aidé l’Estonie, la Lettonie et la Lituanie à obtenir leur indépendance de l’Union soviétique. La révolution chantante a commencé en 1986 avec de grands groupes de citoyens qui se sont rassemblés pour chanter des chansons sur leur héritage. À cette époque, il était illégal pour les gens d’arborer les anciens drapeaux de leur pays ou de faire preuve de patriotisme à l’égard de cet héritage parce qu’ils étaient censés accepter d’être russes.

Les gens se rassemblaient par centaines ou par milliers pour se tenir la main, chanter des chansons de leur pays et agiter de vieux drapeaux. Des festivals de chants patriotiques ont eu lieu pendant des années dans ces pays, et les gens se sont opposés aux chars et autres tentatives du gouvernement russe pour faire taire leurs chants. En 1991, un nouveau gouvernement russe a officiellement reconnu l’indépendance de l’Estonie et d’autres États baltes.

Manifestations de la Navy-Culebra : Porto Rico 1970

En 1970, les habitants de Culebra ont entrepris une série de manifestations contre la marine américaine qui utilisait l’île pour des exercices d’entraînement militaire.

La marine a exproprié 2000 des 7000 acres de l’île pour des exercices de bombardement. Des maisons ont été démolies et des cibles ont été érigées. Une zone d’exclusion de trois miles a été établie autour de l’île.

Les manifestants ont occupé illégalement des zones d’accès restreint, dont Flamingo Beach, et y sont restés pendant plusieurs semaines. Ceux qui avaient besoin de nouvelles maisons squattaient les terres de la marine, qui ont également été utilisées pour la création de zones sportives et de cimetières.

Le président du Parti de l’Indépendance de Porto Rico et leader des protestations, Rubén Berríos, ainsi que treize autres personnes, ont été condamnés à trois mois de prison à Porto Rico pour désobéissance civile et intrusion.

En 1974, tous les partis politiques de Porto Rico ont demandé à la marine américaine de cesser ses opérations et de quitter l’île. Enfin, en 1974, le président Nixon a ordonné à la marine de quitter l’île, ce qu’elle a fait en décembre 1975.

Des lois sur les brevets contraires à l’éthique : 1998 – aujourd’hui

D’énormes entreprises s’emparent des semences pour tenter de contrôler ce que nous mangeons. Les agriculteurs courageux du monde entier risquent la ruine en refusant d’accepter cela.

Suite à une offensive juridique mondiale, les agriculteurs qui ont cultivé et partagé des semences pendant des milliers d’années sont rapidement criminalisés pour leurs actions.

Les agriculteurs perdent leur autonomie. Ils doivent acheter des semences déterminées par les sociétés semencières. Les semences Terminator, par exemple, sont génétiquement modifiées pour devenir stériles après la première germination. Elles sont chères et nécessitent des herbicides et des engrais artificiels, tous fournis, à un coût énorme, par les corporations. L’année suivante, l’agriculteur doit acheter plus de semences et plus d’engrais. Ceux qui ne sont pas ruinés par une dette inéluctable font partie de la chaîne de production des entreprises.

La résistance à la privatisation des semences est mondiale. Les agriculteurs développent des systèmes locaux de semences, risquant des amendes et des peines de prison pour le stockage et le partage des semences. Ils marchent, font la grève, refusent de se retourner. Ils paient des amendes et vont en prison, et parfois ils gagnent.

Les paysans se révoltent : France 1999

Un éleveur de moutons français trouve un moyen symbolique de protester contre l’afflux de multinationales en démantelant un McDonald’s, une brique à la fois.

En 1999, José Bové, avec 300 collaborateurs, a démantelé un McDonald’s à moitié construit à Millau (Aveyron). C’était une action symbolique pour protester contre la mondialisation et la perte de la souveraineté alimentaire au profit des multinationales, c’est-à-dire le droit à une alimentation saine, diversifiée et culturellement appropriée, produite selon des méthodes durables. C’était une action menée, non seulement au nom des producteurs traditionnels français, mais aussi pour ceux du monde entier.

Ce militant éleveur de moutons a inspiré un mouvement de protestation international qui comprenait la Confédération Paysanne, les Associations pour le maintien de l’agriculture paysanne et La Via Campesina, le mouvement paysan international. Ces organisations continuent de réclamer la protection des droits de l’homme, notamment le droit de contrôler l’approvisionnement et la sécurité de sa nourriture.

Bové a été à l’avant-garde du mouvement réussi contre la culture des OGM en France et en Europe. (L’Espagne et le Portugal sont les seuls pays européens qui cultivent des OGM). Il a été membre du Parlement européen avec les Verts européens de 2009 à 2019.

Manifestation place Tiananmen

Une manifestation pacifique qui a entraîné une mort massive a été celle de la place Tiananmen à Pékin, en Chine. La manifestation a commencé au centre ville en avril 1989 avec des manifestants qui ont entamé une grève de la faim et se sont assis sur la place publique. Les participants réclamaient des réformes et des discussions avec les dirigeants du parti communiste.

Après deux mois de protestations sur la place, le gouvernement a envoyé ses forces armées pour faire appliquer la loi martiale et déplacer les manifestants hors de la zone. Sans avertissement, les troupes ont ouvert le feu sur les manifestants pacifiques. Des milliers de personnes ont été blessées, tuées, ou même plus tard jugées et exécutées pour leur participation. Aujourd’hui, la Chine considère que tout discours sur cet incident est tabou et interdit toute discussion ou acte de mémoire.


La désobéissance civile non violente et les manifestations ont également échoué dans d’autres nations non démocratiques. En 1989, une manifestation de plus d’un million de personnes sur la place Tiananmen, à Pékin, a été rapidement dispersée lorsque des chars de l’Armée populaire de libération sont entrés sur la place et que les troupes ont commencé à tirer dans la foule. Des centaines de personnes ont été tuées et des milliers ont été blessées. Pas plus tard qu’en juin 2009, les manifestations en Iran ont trouvé une réponse violente lorsque des civils ont protesté contre l’élection du président sortant Mahmoud Ahmadinejad. En Géorgie, les manifestations pacifiques ont été réprimées avec violence : “Le 7 novembre 2007, les forces gouvernementales [géorgiennes] ont fait usage d’une force violente et excessive pour disperser une série de manifestations largement pacifiques dans la capitale, Tbilissi. Ces pays ont eu recours à la violence pour contrôler les manifestants non violents.

Le concept de désobéissance civile de Thoreau est une méthode efficace pour obtenir un changement dans un gouvernement démocratique. Cela est évident dans les exemples de Mohandas Gandhi en Inde et de Martin Luther King Jr. aux États-Unis. Malheureusement, dans la plupart des cas où la désobéissance civile est utilisée dans des pays non démocratiques, les gouvernements se tournent vers la violence et les populations ne parviennent pas à atteindre leurs objectifs. Ces exemples prouvent que la désobéissance civile n’est pas une stratégie plausible contre un gouvernement non démocratique.

Sources : https://www.ukessays.com/essays/english-literature/ineffective-civil-disobedience.php
https://examples.yourdictionary.com/famous-examples-of-civil-disobedience-in-history.html

Le Jeu de la Mort

Documentaire français de 2009 reprenant l’expérience de Milgram – soumission à l’autorité.
Cette excellente production n’a finalement pas été diffusée malgré la participation de France Télévisions, et vous allez vite comprendre pourquoi.
De l’état actuel des médias au conformisme, que vous connaissiez l’expérience originale ou pas, c’est un documentaire à voir et partager dont le contenu est édifiant.

https://odysee.com/@david.demafate:f/lejeudelamort:6
https://www.bitchute.com/video/pHxm6LE8CWOf/

Comment écrire une lettre à son député local ? (modèle et démarches simplifiées)

Les députés vont être appelés à se prononcer sur la loi Castex qui figure toujours à l’agenda de l’assemblée nationale, projet qui envisage un passeport sanitaire avec restrictions multiples des libertés si non-vaccinés (https://www2.assemblee-nationale.fr/documents/liste/(type)/projets-loi)

Est-ce qu’il y aura encore presque 400 députés absents lors de ces débats cruciaux comme lors du vote de prolongation de l’état d’urgence ?

(Cliquez pour agrandir les affiches)

La prorogation de l’état d’urgence sanitaire a été adoptée au parlement le 7 novembre, elle prévoit la prolongation dudit état d’urgence jusqu’au 16 février 2021, et l’instauration d’un «régime transitoire» jusqu’au 1er avril. Exactement 154 députés ont voté pour, et 38 contre. 385 députés étaient tout simplement absents.

Pour rappel, c’est cet état d’urgence et lui seul qui permet au gouvernement Castex/Véran d’imposer la saison 2 du confinement, c’est aussi cet état d’urgence qui permet d’imposer les multiples interdictions, les auto-attestations et autres délicatesses. Sans état d’urgence, pas de confinement, pas de mesures dictatoriales sans débat au parlement.

Vous en avez assez des mesures absurdes et liberticides ? Assez de l’état d’urgence et des mensonges ? Ecrivez à votre député. Le site de l’assemblée nationale donne l’adresse mail de chacun d’entre eux via un moteur de recherche par commune ou par département.

Cliquez sur le nom du député et vous aurez son adresse email.

En attendant, voici la liste des parlementaires qui ont voté contre la prorogation de l’état d’urgence, suivie de celle des parlementaires qui ont voté pour. Pour la liste des absents, il faudra procéder par élimination.

Contre
Pour

A prendre en considération les 44 députés qui ont quitté LREM depuis 2017.

https://www.lefigaro.fr/politique/le-scan/depuis-2017-le-groupe-lrem-perd-un-depute-tous-les-deux-mois-et-demi-20191113)

Écrire à son député, c’est établir un contact avec quelqu’un qui peut franchir le pas de la dissidence et ainsi affaiblir le gouvernement, l’empêchant d’agir en dictateur comme il le fait depuis 9 mois, prenant la population en otage pour satisfaire les appétits illimités de Big Pharma, en l’occurrence, le vaccin.

Ci-dessous une propositions de lettre, à personnaliser au maximum, une règle : rester courtois, insulter ne sert à rien et est totalement contre-productif.

un paragraphe sera différent selon que le député a voté pour, était absent ou dissident,

Madame, Monsieur,

Au moment des élections, j’ai choisi de soutenir une nouvelle formation, la vôtre, pensant nécessaire de renouveler l’appareil politique de la République. Pour vous aussi, c’était une nouvelle aventure. Malheureusement, le gouvernement a utilisé le fait que nombre de députés étaient novices en politique pour les manipuler et obtenir les pleins pouvoirs. Depuis des mois, en raison de la pandémie (déclarée telle par l’OMS), la population est prise en otage.

Nous sommes menacés physiquement car le gouvernement a osé prendre une mesure inimaginable : empêcher les médecins de soigner, d’utiliser des traitements qui fonctionnent afin de mettre en avant un remède coûteux, inutile et dangereux des laboratoires Gilead : le remdesivir. Tout le monde connaît maintenant ce scandale. Et à ce jour, les médecins ont toujours des restrictions de prescription totalement injustifiées.

La population est menacée psychologiquement par une mise en scène quotidienne de faux chiffres, de faux positifs, de fausse “deuxième vague”. Les médecins qui osent dénoncer cette mise en scène le font à leurs risques et périls comme nous le savons avec les pr Raoult et Perronne.

La population est menacée émotionnellement, le port du masque – inutile pour des biens portants -, imposé à tous, y compris les enfants à l’école, vise à nourrir un sentiment d’insécurité et de menace. La fermeture totalement injustifiée de tous les lieux de convivialité et de détente depuis des mois contribue à plonger les gens dans un état d’abattement et de dépression.

La population est menacée dans ses libertés fondamentales d’aller et venir, de faire du sport, de se promener, de se rencontrer, menacée sans cesse d’amendes absurdes, contribuant à faire peser une véritable chape de plomb sur toute la société.

La population est menacée financièrement par des mesures qui détruisent l’économie et vont être la cause de faillites en cascade et de chômage.

Version 1 : le ou la député a voté pour

Tout cela a été possible par le soutien de la majorité LREM, soutien que vous avez voté. De plus en plus nombreux sont les députés qui quittent la majorité actuelle pour ne pas cautionner cette politique – injustifiable médicalement parlant- de dictature sanitaire, je vous demande de les rejoindre et de défendre la population qui est menacée dans ses droits les plus fondamentaux.

Version 2 : le ou la député était absent(e)

Tout cela a été possible par le soutien de la majorité LREM, apparemment, vous étiez absent de l’hémicycle en ce jour pourtant si lourd de conséquences pour les français.

De plus en plus nombreux sont les députés qui quittent la majorité actuelle pour ne pas cautionner cette politique – injustifiable médicalement parlant- de dictature sanitaire, je vous demande de les rejoindre et de défendre la population qui est menacée dans ses droits les plus fondamentaux.

Version 3 : le ou la député a quitté la majorité

Tout cela a été possible par le soutien de la majorité LREM. Vous avez, depuis, quitté cette majorité, pour ne pas cautionner cette politique – injustifiable médicalement parlant- de dictature sanitaire, je vous assure de mon soutien et compte sur vous pour défendre la population qui est menacée dans ses droits les plus fondamentaux.

Le gouvernement est asservi aux intérêts des laboratoires pharmaceutiques. L’interdiction de prescription de l’hydroxychloroquine et de tous les traitements qui fonctionnent a été la cause de milliers de morts, le confinement avec ses atteintes aux libertés vise à nous faire accepter un vaccin inutile.

Les infos abondent désormais sur la réalité de la faible dangerosité du covid, qui ne tue que 0,05 % de la population, des gens âgés souffrant de multiples pathologies, pourtant le gouvernement ne jure que par le vaccin pour tous, cette position, comme le confinement est adopté dans la plupart des pays occidentaux, et s’auto-valide par ce fait même d’être imposée partout, mais cette similitude de comportement signifie simplement que les laboratoires pharmaceutiques ont implanté partout les mêmes pions avec les mêmes conflits d’intérêts, se basant sur les mêmes raisonnement biaisés et les mêmes fausses études.

La dictature sanitaire du gouvernement vise à une dictature vaccinale, d’imposer à la planète entière un passeport vaccinal qui contrevient à toutes les libertés. Un vaccin est un geste irréversible, obliger les gens à se faire vacciner pour un risque imaginaire et mis en scène est une atteinte gravissime des droits humains les plus fondamentaux.

Je compte sur vous pour défendre la population contre ce dessein criminel.

Avec toute ma considération,

Signature

Covid : l’illusion du contrôle

Comme le montre le graphique ci-dessous, les décès liés au covid en Suède – sans confinement, sans masque obligatoire et avec l’une des plus faibles capacités de soins intensifs d’Europe – sont presque identiques à la moyenne de l’UE et nettement inférieurs à ceux des États-Unis. En d’autres termes, les nombreuses mesures proposées par de supposés experts ont été largement inefficaces sur le plan médical, mais très destructrices sur le plan social et économique.

La seule intervention efficace pour réduire les maladies graves et les décès – en l’absence de contrôles aux frontières précoces ou de politiques totalitaires – a été ignorée ou bloquée par la plupart des autorités sanitaires occidentales : un traitement précoce et prophylactique fondé sur des preuves. Il est possible que ce traitement ait été tout simplement trop économique.

Les lecteurs du SPR ont été parmi les premiers au monde à obtenir les faits réels sur le profil véritable de la mortalité des malades du covid, l’importance énorme des maisons de retraite (encore ignorées par la plupart des modélisateurs de l’IFR), l’inefficacité des masques en tissu, des mesures de confinement et de “traçage des contacts”, la fraude du remdesivir, les manigances contre l’HCQ, la réalité sur les effets à long terme, le désastre des ventilateurs, le problème des tests PCR, l’hypothèse de l’origine du virus des mineurs de Mojiang, la désinformation généralisée des médias et les options de traitement précoce efficaces.

Dans l’ensemble, la pandémie de covid est plus proche d’une pandémie de grippe moyenne (comme en 1957 et 1968) frappant les populations âgées des pays industrialisés avec un taux élevé de maladies cardiovasculaires. À l’exception notable des enfants et de l’Afrique noire, le covid est nettement plus grave que la “grippe saisonnière”, mais nettement moins grave que la grippe de 1918 et les pandémies mondiales précédentes.

Tableau supplémentaire : Dakota du Nord vs Dakota du Sud

Source : https://swprs.org/covid-the-illusion-of-control/ Traduction : https://cv19.fr

OMS : Une pandémie plus grave que le COVID arrive

“Cette pandémie a été très grave… elle a touché tous les coins de la planète. Mais ce n’est pas nécessairement la plus grave.”

L’Organisation mondiale de la santé a averti qu’une pandémie pire que celle de COVID pourrait être imminente et que ce que nous avons vu jusqu’à présent en 2020 n’est “pas nécessairement la plus importante”.

Avec les confinements internationaux, les atteintes aux libertés et la décimation des petites entreprises et de l’économie dans son ensemble, il est difficile d’imaginer comment la situation pourrait s’aggraver.

Pourtant, l’OMS prédit que cela pourrait très bien être le cas.

Le responsable du programme d’urgence de l’OMS, le Dr Mike Ryan, a déclaré lors d’un point de presse que “cette pandémie a été très grave … elle a touché tous les coins de la planète. Mais ce n’est pas nécessairement la plus grave.”

“C’est un signal d’alarme. Nous apprenons, maintenant, à mieux faire les choses : science, logistique, formation et gouvernance, comment mieux communiquer. Mais la planète est fragile”, a ajouté M. Ryan.

“Nous vivons dans une société mondiale de plus en plus complexe. Ces menaces vont persister. S’il y a une chose que nous devons retenir de cette pandémie, avec toute la tragédie et les pertes qu’elle entraîne, c’est que nous devons agir ensemble. Nous devons honorer ceux que nous avons perdus en nous améliorant chaque jour”, a-t-il poursuivi.

M. Ryan a également déclaré que malgré le vaccin, le virus est appelé à devenir endémique et ne disparaîtra jamais.

“Le scénario probable est que le virus deviendra un autre virus endémique qui restera en quelque sorte une menace”, a déclaré M. Ryan.

Le professeur David Heymann, président du groupe consultatif stratégique et technique de l’OMS pour les risques infectieux, a ajouté que “le destin du SARS-CoV-2 [Covid-19] semble être de devenir endémique, comme l’ont été quatre autres coronavirus humains, et qu’il continuera à muter en se reproduisant dans les cellules humaines, en particulier dans les zones d’admission plus intense”.

Ailleurs au cours de la réunion, la Dre Soumya Swaminathan, responsable scientifique de l’OMS, a déclaré que le lancement des vaccins ne signifiait pas que la distanciation sociale ou le port de masque devaient disparaître.

“Je ne pense pas que nous ayons les preuves de l’efficacité de ces vaccins pour être sûrs qu’ils empêcheront les gens de contracter l’infection et donc de la transmettre”, a déclaré la Dre Swaminathan.

“I don’t believe we have the evidence on any of the vaccines to be confident that it’s going to prevent people from actually getting the infection and therefore being able to pass it on”, says WHO Chief Scientist @doctorsoumya pic.twitter.com/QdTvzj7Nyd

— Disclose.tv 🚨 (@disclosetv) December 28, 2020

Ces commentaires font suite à l’avertissement de Mme Swaminathan selon lequel les mesures de confinement restrictives ne cesseront pas avant “fin 2021”, date à laquelle “l’immunité de la population” sera obtenue.

“Il faudra attendre la fin de 2021 pour voir un certain niveau d’immunité de la population dans certains pays”, a déclaré M. Swaminathan la semaine dernière.

Comme nous l’avons signalé il y a deux semaines, l’Institut international pour la démocratie et l’assistance électorale (IDEA), basé en Suède, a constaté que la majorité des nations du monde ont mis en œuvre des restrictions liées au COVID qui ont gravement érodé les libertés de leurs citoyens.

L’étude a révélé que 61 % des pays ont utilisé des restrictions “qui étaient préoccupantes du point de vue de la démocratie et des droits de l’homme”.

Ces [restrictions] ont violé les normes démocratiques parce qu’elles étaient soit disproportionnées, soit illégales, soit indéfinies ou inutiles par rapport à la menace sanitaire”, a déclaré le groupe dans son rapport.

Si une pandémie plus importante se profile, comme le promet l’OMS, il est clair que ces atteintes à la liberté seront encore plus importantes si ce même modèle se poursuit.

Source : https://www.zerohedge.com/covid-19/who-bigger-pandemic-covid-coming
Traduction : https://www.aubedigitale.com/oms-une-pandemie-plus-grave-que-le-covid-arrive/

ajax-loader