Category: Divers

Le SARS-CoV-2 est en réalité un virus généré par ordinateur

Par Makia Freeman

Les scientifiques du CDC (Center for Disease Control) ont fait des aveux qui détruisent totalement le récit officiel du COVID dans une étude publiée en juin 2020 intitulée Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with Coronavirus Disease, United States.

Ce qui est intéressant dans toute cette escroquerie, c’est que lorsque l’on creuse assez profondément, la vérité est là – et elle est admise par les sources officielles – mais il faut beaucoup de persévérance pour percer le labyrinthe propagandiste de l’information.

Dans cet article, nous allons examiner la signification de ce que les scientifiques du CDC ont révélé, à savoir que pour leurs recherches sur le prétendu nouveau virus SARS-CoV-2, ils n’ont utilisé que 37 paires de bases provenant de véritables échantillons de tissus et ont rempli le reste (environ 30 000 paires de bases) avec des séquences générées par ordinateur, c’est-à-dire qu’ils l’ont inventé !

La seconde déclaration est tout aussi étonnante : après les tests, ils ont découvert que le SRAS-CoV-2 ne pouvait pas infecter les tissus humains.

N°1 : Le virus Frankenstein généré par ordinateur : Les scientifiques du CDC admettent n’avoir utilisé que 37 paires de bases de tissus réels pour assembler le SARS-CoV-2

Dans un article précédent, j’ai expliqué que le SARS-CoV-2 est un virus Frankenstein, car il s’agit d’une création numérique abstraite générée par ordinateur, et non d’un virus vivant. Il n’a jamais été correctement purifié et isolé de manière à pouvoir être séquencé de bout en bout une fois dérivé de tissus vivants ; au lieu de cela, il est simplement assemblé numériquement à partir d’une base de données virale informatique. Les scientifiques du CDC affirment qu’ils n’ont pris que 37 paires de bases d’un génome de 30 000 paires de bases ! Cela signifie qu’environ 0,001% de la séquence virale est dérivée d’échantillons vivants réels ou de tissus corporels réels. Voici la citation :

“Séquençage du génome entier

Nous avons conçu 37 paires de PCR emboîtées couvrant le génome sur la base de la séquence de référence du coronavirus (n° d’accès GenBank NC045512). Nous avons extrait l’acide nucléique des isolats et l’avons amplifié en utilisant les 37 PCR individuelles emboîtées”.

Il est intéressant de noter que dans le paragraphe suivant, les scientifiques du CDC disent avoir utilisé la “PCR quantitative” pour une analyse/construction plus poussée, ce qui va à l’encontre de ce que Kary Mullis, l’inventeur de la PCR, a dit un jour – à savoir que “la PCR quantitative est un oxymore” puisque la PCR est par nature une technique qualitative et non quantitative. J’ai parlé de l’utilisation abusive du test PCR dans toute cette escroquerie COVID dans d’autres articles comme celui-ci. Dans son article “Seules les cellules rénales de singe empoisonnées ont “grandi” avec le “virus”“, le Dr Thomas Cowan souligne cette fraude scientifique :

“… nous constatons qu’au lieu d’avoir isolé le virus et de séquencer le génome de bout en bout, ils ont trouvé 37 paires de bases à partir d’échantillons non purifiés en utilisant des sondes PCR. Cela signifie qu’ils ont en fait examiné 37 des quelque 30 000 paires de bases qui sont censées constituer le génome du virus intact. Ils ont ensuite pris ces 37 segments et les ont mis dans un programme informatique, qui a rempli le reste des paires de bases.

Pour moi, cette étape de génération d’un ordinateur constitue une fraude scientifique. Voici une équivalence : Un groupe de chercheurs prétend avoir trouvé une licorne parce qu’ils ont trouvé un morceau de sabot, un poil de queue et un bout de corne. Ils ajoutent ensuite ces informations dans un ordinateur et le programment pour recréer la licorne, et ils prétendent ensuite que cette recréation informatique est la véritable licorne. Bien sûr, ils n’avaient jamais vu de licorne et n’auraient donc pas pu examiner sa composition génétique pour comparer leurs échantillons avec les cheveux, les sabots et la corne de la licorne réelle”.

La science pure ou la science véritable tente de prouver qu’il en est ainsi ; la science véritable n’a donc pas de place pour la politique, les règles de la majorité ou le consensus. Pourtant, selon Cowan, le consensus a été utilisé pour déterminer quel modèle numérique SARS-CoV-2 était le plus vrai des faux modèles :

“Les chercheurs affirment qu’ils ont décidé du véritable génome du SARS-CoV-2 par “consensus”, un peu comme un vote. Là encore, différents programmes informatiques vont proposer différentes versions de la “licorne” imaginaire, de sorte qu’ils se réunissent en groupe et décident quelle est la licorne imaginaire réelle”.

n°2 : Les scientifiques du CDC ont découvert que le SARS-CoV-2 n’avait pas infecté les tissus humains

Une grande partie de l’histoire officielle qu’on nous a racontée était que le COVID était une nouvelle maladie dangereuse et imprévisible qui se répandait rapidement et était mortelle. Eh bien, elle n’est apparemment pas très mortelle puisque les scientifiques du CDC ont découvert qu’elle ne pouvait même pas infecter les cellules humaines in vitro. Ils ont testé le “virus” (pas vraiment, mais les solutions déclarées comme contenant des échantillons de SARS-CoV-2) sur 3 différents types de cultures de tissus humains (cellules d’adénocarcinome humain [A549], cellules de foie humain [HUH 7.0] et cellules de rein embryonnaire humain [HEK-293T]). Le “virus” n’a pu infecter aucune des trois cultures de tissus humains. Voici la citation :

“… nous avons examiné la capacité du SARS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, y compris des cellules d’adénocarcinome humain (A549), des cellules de foie humain (HUH7.0) et des cellules de rein embryonnaire humain (HEK-293T), en plus des cellules Vero E6 et Vero CCL81. Nous avons également examiné une lignée de cellules de rein de grande chauve-souris brune (EFK3B) disponible pour la capacité de réplication du SARS-CoV-2. Chaque lignée cellulaire a été inoculée à une grande multiplicité d’infections et examinée 24 heures après l’infection … Aucun CPE n’a été observé dans aucune des lignées cellulaires sauf dans les cellules Vero, qui ont atteint >107 PFU 24 heures après l’infection. En revanche, les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste, et les cellules A549 étaient incompatibles avec l’infection par le SARS-CoV-2. Ces résultats concordent avec les résultats précédents de sensibilité au SARS-CoV et suggèrent que d’autres systèmes de culture courants, notamment les cellules MDCK, HeLa, HEP-2, MRC-5 et les ovules embryonnés, ne sont pas susceptibles de favoriser la réplication du SARS-CoV-2. En outre, le SARS-CoV-2 ne s’est pas répliqué dans les cellules EFK3B des chauves-souris, qui sont sensibles au MERS-CoV. Ensemble, les résultats indiquent que le SARS-CoV-2 conserve un profil similaire au SARS-CoV en termes de lignées cellulaires susceptibles”.

CPE signifie effet cytopathique ou effet cytopathogène et fait référence aux changements structurels des cellules causés par l’invasion virale. Aucun CPE n’a été trouvé dans les cellules de tissus humains, mais seulement dans les cellules vero (cellules animales, dans ce cas-ci des cellules de singe). La principale conclusion de cette citation est que deux cultures ne présentent qu’une réplication virale modeste, que l’autre tissu n’en présente aucune et que d’autres cultures humaines courantes sont “peu susceptibles de favoriser la réplication du SARS-CoV-2”, ce qui signifie que le SARS-CoV-2 ne les infectera pas ! Ainsi, même selon les règles de leur propre jeu, le SARS-CoV-2 n’est pas un agent infectieux pour les humains. Voici l’analyse du Dr Cowan :

“Que signifie réellement ce langage et pourquoi est-ce la déclaration la plus choquante de toutes de la communauté virologique ? Lorsque les virologistes tentent de prouver une infection, ils disposent de trois “hôtes” ou modèles possibles sur lesquels ils peuvent faire des tests. Le premier est l’homme. L’exposition aux humains n’est généralement pas faite pour des raisons éthiques et n’a jamais été faite avec le SARS-CoV-2 ou tout autre coronavirus. Le deuxième hôte possible est l’animal. Oubliant un instant qu’ils n’utilisent jamais réellement de virus purifié lorsqu’ils exposent des animaux, ils utilisent des solutions dont ils prétendent qu’elles contiennent le virus. L’exposition aux animaux a été faite une fois avec le SARS-CoV-2, lors d’une expérience qui a utilisé des souris. Les chercheurs ont découvert qu’aucune des souris sauvages (normales) n’était malade. Dans un groupe de souris génétiquement modifiées, un nombre statistiquement insignifiant de souris a perdu un peu de fourrure. Elles n’ont pas du tout souffert de la maladie appelée Covid 19.

La troisième méthode utilisée par les virologistes pour prouver l’infection et la pathogénicité – la méthode sur laquelle ils s’appuient le plus – est l’inoculation de solutions qui, selon eux, contiennent le virus sur une variété de cultures de tissus. Comme je l’ai souligné à maintes reprises, il n’a jamais été démontré qu’une telle inoculation tue (lyse) les tissus, à moins qu’ils ne soient d’abord affamés et empoisonnés.

Ce qui est choquant dans la citation ci-dessus, c’est que les virologistes ont découvert, en utilisant leurs propres méthodes, que les solutions contenant le SARS-CoV-2 – même en grande quantité – n’étaient pas, je répète, PAS infectieuses pour aucune des trois cultures de tissus humains qu’ils ont testées. En clair, cela signifie qu’ils ont prouvé, selon leurs propres termes, que ce “nouveau coronavirus” n’est pas infectieux pour les êtres humains. Il est UNIQUEMENT infectieux pour les cellules rénales de singe, et seulement lorsque vous ajoutez au mélange deux médicaments puissants (gentamicine et amphotéricine), connus pour être toxiques pour les reins.

Mes amis, lisez ceci encore et encore. Ces virologistes, publiés par le CDC, ont réalisé une preuve claire, selon leurs termes, montrant que le virus SARS-CoV-2 est inoffensif pour les êtres humains. C’est la seule conclusion possible, mais, malheureusement, ce résultat n’est même pas mentionné dans leur conclusion”.

Ces 2 nouvelles révélations sur le COVID font encore plus couler le récit officiel

Et voilà : encore plus de fraude scientifique sous la forme de ces deux révélations sur le COVID, et encore plus de preuves montrant qu’il n’y a pas de vrai virus, et quel que soit le “virus”, il n’y a certainement rien à craindre si vous êtes un humain – ce qui est probablement le cas si vous lisez ceci. Ces révélations sur le COVID montrent que la vérité est souvent cachée au grand jour, et que les personnes en position de pouvoir doivent toujours être examinées avec soin. Nous devons appliquer un esprit critique à tout ce qui provient de sources officielles.

Je tire mon chapeau à Sally Fallon Morrell et au Dr Thomas Cowan de la Fondation Weston A. Price.

Voir aussi : Comment créer votre propre “nouveau virus” généré par ordinateur

Source : https://principia-scientific.com/revealed-covid19-is-really-a-cdc-computer-generated-virus/
Traduction par https://cv19.fr

Une fuite vidéo expose Mark Zuckerberg qui déclare que les vaccins COVID-19 changent l’ADN

Selon une vidéo diffusée par un collaborateur de Facebook, on voit Mark Zuckerberg admettre que les vaccins COVID-19 vont changer votre ADN et qu’il n’est pas sûr des effets à long terme de ces vaccins. Il est intéressant de noter que, conformément à sa propre politique, Facebook vous censurera pour avoir dit exactement la même chose, même avec des preuves, et le considérera comme une fausse nouvelle.

“nous ne connaissons tout simplement pas les effets secondaires à long terme de plus ou moins modifier l’ADN et l’ARN des gens”

Selon l’annonce faite par Facebook la semaine dernière, ils “étendent [leurs] efforts pour supprimer les fausses déclarations sur Facebook et Instagram concernant COVID-19, les vaccins COVID-19 et les vaccins en général pendant la pandémie”.

Facebook a également confirmé qu’il supprimera les affirmations selon lesquelles les vaccins modifient l’ADN des personnes.

Cependant, selon une vidéo (voir ci-dessous) divulguée par un collaborateur de Facebook à Project Veritas, on peut voir Mark Zuckerberg contredire sa propre politique concernant les vaccins COVID-19

Mark Zuckerberg, PDG de Facebook en juillet 2020, a déclaré

“Mais je veux juste m’assurer que je partage une certaine prudence sur ce [vaccin] parce que nous ne connaissons pas les effets secondaires à long terme de la modification de l’ADN et de l’ARN des gens… essentiellement la capacité de produire ces anticorps et si cela entraîne d’autres mutations ou d’autres risques en aval. Donc, il y a des travaux sur les deux voies de développement du vaccin”.

Cependant, dans le cadre de sa nouvelle politique, Facebook a déclaré spécifiquement qu’il supprimera toutes les affirmations selon lesquelles les vaccins modifient l’ADN d’un individu.

Source : https://www.projectveritas.com/news/facebook-ceo-mark-zuckerberg-takes-anti-vax-stance-in-violation-of-his-own/
https://greatgameindia.com/mark-zuckerberg-vaccines-dna/

Simulation de cyberpandémie : Cyber Polygone 2021

Cyber Polygone 2021 sera-t-il aussi prophétique que l’événement 201 dans la simulation d’une réponse à une pandémie ?

Le Forum économique mondial (FEM) organisera un autre exercice de cyber-attaque alors qu’il continue à se préparer à une éventuelle cyber-pandémie qui, selon le fondateur Klaus Schwab, sera pire que la crise mondiale actuelle.

Le piratage de SolarWinds a réveillé les vulnérabilités d’attaque de la chaîne d’approvisionnement encore présentes dans les organisations publiques et privées, et a servi d’avertissement que la prochaine brèche pourrait être pire de manière exponentielle en se propageant à travers tout appareil connecté à Internet.

Dans le prolongement de l’exercice de cyberattaque Cyber Polygon de l’année dernière et de l’événement visant à prévenir une pandémie numérique, le FEM a annoncé que l’édition 2021 aura lieu le 9 juillet.

“Une cyber-attaque avec des caractéristiques semblables à celles du COVID se répandrait plus vite et plus loin que n’importe quel virus biologique” – Forum économique mondial

Cette année, Cyber Polygone 2021 simulera une cyber-attaque fictive avec des participants de dizaines de pays répondant à “une attaque ciblée de la chaîne d’approvisionnement sur un écosystème d’entreprise en temps réel”.

Selon le FEM, le COVID-19 était connu comme un risque prévisible, tout comme son équivalent numérique.

De plus, “une cyber-attaque avec des caractéristiques semblables au COVID se répandrait plus vite et plus loin que n’importe quel virus biologique. Son taux de reproduction serait environ 10 fois plus élevé que celui que nous avons connu avec le coronavirus”.

“Il est important d’utiliser la crise COVID-19 comme une occasion opportune de réfléchir aux leçons de la communauté de la cybersécurité pour tirer et améliorer notre impréparation à une éventuelle cyberpandémie” – Klaus Schwab

Nous examinons ici trois tendances qui se dégagent de Cyber Polygone 2020 afin de découvrir les mesures que les secteurs public et privé pourraient prendre en prévision d’une pandémie numérique.

Mais d’abord, d’où vient la notion de cyberpandémie ?

Une cyberpandémie attendue

Dans son discours de bienvenue à Cyber Polygone 2020, le fondateur du FEM, Klaus Schwab, a mis en garde contre une “cyber-pandémie” à venir qui serait pire que la crise mondiale actuelle.

“Nous sommes tous conscients, mais nous n’y prêtons pas encore suffisamment attention, du scénario effrayant d’une cyber-attaque globale, qui mettrait un terme complet à l’approvisionnement en électricité, aux transports, aux services hospitaliers, à notre société dans son ensemble”, a-t-il déclaré.

“La crise COVID-19 serait considérée à cet égard comme une petite perturbation par rapport à une cyber-attaque majeure”.

Schwab a ajouté : “Il est important d’utiliser la crise COVID-19 comme une occasion opportune de réfléchir aux leçons de la communauté de la cybersécurité pour tirer et améliorer notre impréparation à une éventuelle cyberpandémie”.

Alors que le monde numérique empiète sur nos mondes physique et biologique, une cyber-attaque efficace pourrait compromettre tout ce qui est connecté à l’internet, y compris :

  • Des dispositifs médicaux qui maintiennent les gens en vie
  • L’Internet des objets (IoT), écosystème de dispositifs connectés qui font fonctionner les maisons intelligentes (c’est-à-dire les caméras, les microphones, les capteurs, etc.)
  • L’internet des corps (IoB) écosystème d’êtres humains connectés numériquement
  • Systèmes financiers mondiaux
  • Réseaux d’énergie
  • Installations de traitement de l’eau
  • Systèmes informatiques du gouvernement
  • Infrastructure militaire et de défense
  • Et plus encore

Actuellement, “La seule façon d’arrêter la propagation exponentielle d’une menace de cyber-attaque de type COVID”, selon le FEM, “est de déconnecter complètement les millions de dispositifs vulnérables les uns des autres et de l’Internet”.

Mais, “un seul jour sans Internet coûterait à nos économies plus de 50 milliards de dollars, et ce avant d’envisager les dommages économiques et sociétaux si ces dispositifs étaient liés à des services essentiels, tels que les transports ou les soins de santé”.

“La crise COVID-19 serait considérée à cet égard comme une petite perturbation par rapport à une cyber-attaque majeure” – Klaus Schwab

Il va sans dire qu’une cyberpandémie ferait des ravages dans presque tous les aspects de la société.

Mais le diable est dans les détails, et les solutions recommandées pour une cyberpandémie pourraient être bien plus préjudiciables à la liberté individuelle que la cyberattaque elle-même.

Cyber Polygone 2020 : tendances émergentes

Le thème central de l’exercice Cyber Polygone 2020 était “pandémie numérique : comment prévenir une crise et renforcer la cybersécurité à tous les niveaux”.

L’objectif de l’événement Cyber Polygone de l’année dernière était de :

  • Développer les compétences des équipes pour repousser les cyberattaques
  • Engager la direction des organisations et des entreprises mondiales dans le dialogue sur la cybersécurité
  • Sensibiliser le public à la cybersécurité

L’exercice comportait deux volets parallèles : un flux en direct pour un public de masse et une formation technique pour les spécialistes de la cybersécurité. 120 des plus grandes organisations russes et internationales de 29 pays se sont jointes à la formation technique pour s’entraîner à réagir à une attaque ciblée, visant à pirater les données d’une entreprise et à porter atteinte à sa réputation.

Alors que la partie formation technique de l’événement était consacrée à la réponse à une seule attaque, les conversations des parties en direct ont fourni le plus d’informations pour faire face aux retombées potentielles de l’attaque – la pandémie numérique.

Voici trois tendances qui se dégagent des discussions en direct et du rapport sur les résultats de Cyber Polygone 2020.

1) Les gouvernements évolueront inévitablement vers des systèmes d’identité numérique

S’exprimant à Cyber Polygone 2020, l’ancien Premier ministre britannique Tony Blair a déclaré avec confiance que les gouvernements se dirigent “absolument, inévitablement” vers l’adoption de l’identité numérique.

“”L’identité numérique représente pour moi une part très importante de l’avenir” – Tony Blair

L’identité numérique est une composante majeure du programme de Grand Reset du FEM, car elle est liée aux technologies de transition qui alimentent la quatrième révolution industrielle.

Une identité numérique enregistre tout ce que vous faites en ligne, y compris ce que vous partagez sur les réseaux sociaux, les sites web que vous visitez et la géolocalisation de votre smartphone, et elle peut contenir toutes les données d’identification que vous trouvez normalement dans un portefeuille physique, comme votre permis de conduire, votre carte d’assurance et vos cartes de crédit.

Dans son exposé, M. Blair n’a pas expliqué pourquoi il était nécessaire d’avoir une identité numérique pour prévenir une cyberpandémie, mais plutôt que les identités numériques seraient une partie inévitable de l’écosystème numérique, et que les gouvernements devraient donc travailler avec les entreprises technologiques pour protéger et réglementer leur utilisation.

“L’identité numérique représente pour moi une part très importante de l’avenir”, a déclaré M. Blair.

“Inévitablement, les gouvernements vont aller dans cette direction – absolument, inévitablement”, a-t-il ajouté.

“Et donc, ce qui me semble le plus important, c’est que nous, du côté politique, nous réveillions au potentiel de la technologie et que nous nous engagions avec les créateurs de changement qui inventent la technologie, afin que nous la comprenions et que nous puissions la réglementer de manière sensée et non stupide”.

Source : World Economic Forum

Si un hacker parvenait à contrôler l’identité numérique d’une personne, il pourrait fondamentalement l’empêcher de participer à la société civile en l’effaçant complètement ou en exploitant ses informations de manière à empêcher les victimes de prouver qu’elles ont de l’argent en banque, un passeport qui leur permet de voyager, un permis de conduire valide, une preuve d’immunité et tout autre justificatif nécessaire aux citoyens pour accéder aux biens et aux services.

Et si les identités numériques sont susceptibles d’améliorer les moyens de subsistance de millions de personnes lorsqu’elles sont gérées de manière éthique, elles sont également utilisées par des gouvernements autoritaires pour profiler et contrôler le comportement des citoyens dans le cadre d‘un système de crédit social.

Que les données soient sécurisées ou non, la liberté individuelle dépendra de la manière dont la technologie est utilisée et du niveau de confiance accordé à ceux qui la gouvernent.

Selon un rapport du FEM de 2018, “l’identité numérique détermine les produits, les services et les informations auxquels nous pouvons accéder – ou, à l’inverse, ce qui nous est interdit” – dont le niveau sera déterminé par notre comportement en ligne.

Si Blair a raison et que les gouvernements adopteront inévitablement des identités numériques, alors une cyber-attaque bien coordonnée affectant les systèmes d’identité numérique conduirait à une cyber-pandémie affectant l’ensemble de la société.

2) Les “Fake News” sont une pandémie numérique et la majorité des citoyens sont incapables de penser de manière critique

Cyber Polygone 2020 a consacré l’une de ses sessions de streaming en direct au concept de “Fake News” comme étant une pandémie numérique mortelle qui sévit en 2020.

“Si vous parlez de quelqu’un qui […] n’a pas beaucoup lu, dont les connaissances sont limitées – cette personne est beaucoup plus facile à tromper et beaucoup plus prête à accepter tout ce qu’on lui dit” – Vladimir Pozner, Journaliste

À la fin de leur conversation, le présentateur de BBC World News, Nik Gowing, et le journaliste chevronné Vladimir Pozner sont arrivés à la conclusion que la personne moyenne en âge de voter n’était pas capable de penser de manière critique pour elle-même et était plus susceptible d’avaler n’importe quelle information diffusée que quelqu’un qui a fait des études universitaires.

Gowing et Pozner ont tous deux reconnu que la majorité des citoyens n’étaient pas instruits, n’étaient pas bien informés et n’avaient pas suffisamment voyagé pour faire la différence entre ce qui était faux et ce qui était réel.

Pozner : “Vous lancez votre argumentation en partant du principe que le téléspectateur, l’auditeur, le lecteur moyen a un regard critique dès le départ.

“Je pense qu’il y a beaucoup de gens qui n’ont pas ce sens critique et qui ne font qu’avaler le tout.

Gowan : “Je suis d’accord […] “Vous devez avoir cet instinct de remise en question.”

Pozner : “Si quelqu’un est bien éduqué, a fait des études universitaires, a lu, a voyagé – la réaction de cette personne à ce qu’elle lit ou écoute est une chose.

“Si vous parlez d’une personne qui a terminé le lycée ou un autre établissement similaire et qui n’en a pas eu l’occasion en raison de ses origines, qui n’a pas beaucoup lu et dont les connaissances sont limitées, cette personne est beaucoup plus facile à tromper et beaucoup plus prête à accepter ce qu’on lui dit.

“Lorsqu’il s’agit de ce mensonge délibéré, à qui s’adresse-t-il principalement ?

À mon avis, il s’adresse principalement à la personne ordinaire – non pas à l’élite intellectuelle, non pas à ceux qui ont la capacité de réfléchir réellement, mais à ceux qui n’ont pas eu cet avantage, aux personnes moins privilégiées qui sont la majorité, et qui sont celles qui votent, et qui sont celles qui, en fin de compte, quand elles disent “le peuple”, elles sont “le peuple”, et je pense que ce sont elles qui sont victimes de cette tendance.

Partant du principe que les gens ordinaires ne sont pas capables de penser de manière critique et que la majorité des citoyens sont donc des “victimes”, les deux journalistes ont orienté la conversation sur la manière de protéger les victimes de la “pandémie des fake news”.

Mais en fin de compte, ils n’avaient aucune idée de la manière de procéder, et les fake news et la désinformation restent des “menaces existentielles”.

Cyber Polygone 2020 n’a pas émis de recommandations concrètes concernant le traitement des fake news ; cependant, la simulation de pandémie de coronavirus de l’événement 201 du FEM a recommandé que “les gouvernements devront s’associer aux entreprises de médias traditionnels et de réseaux sociaux pour rechercher et développer des approches agiles pour contrer la désinformation”.

3) Les partenariats publics et privés fiables devront être renforcés

L’établissement de collaborations fiables entre les secteurs public et privé peut aider à prévenir une pandémie numérique, selon le rapport Polygone 2020.

“Une situation critique ne peut être traitée par une organisation ou un individu isolé”, peut-on lire dans le rapport, qui ajoute : “Dans un monde fortement interconnecté, une seule cyber-attaque peut se propager de manière exponentielle à travers la communauté mondiale.

“Cette situation peut être évitée en encourageant la collaboration entre les secteurs public et privé et les services de maintien de l’ordre.

“En outre, une interaction efficace nécessite la mise en œuvre et la réglementation d’une série de normes, l’échange d’informations et l’établissement de relations de confiance”.

“Lorsque nous verrons la prochaine crise, elle sera plus rapide que ce que nous avons vu avec le COVID, le taux de croissance exponentielle sera beaucoup plus rapide, l’impact sera plus important et, par conséquent, les implications économiques et sociales seront encore plus significatives” – Jeremy Jurgens, directeur général du FEM

Cependant, avec des pays comme la Chine qui volent la propriété intellectuelle, qui parrainent des cyberattaques dirigées par l’État qui ont compromis les informations personnelles de presque tous les adultes américains, et qui réduisent au silence les médecins et les lanceurs d’alerte sur la responsabilité du PCC dans la pandémie de coronavirus, établir la confiance et renforcer les collaborations entre les gouvernements et les entreprises sont des objectifs nobles à fixer.

Lors de la session en direct de Polygone 2020, Jeremy Jurgens, directeur général du FEM, a déclaré que pour prévenir la prochaine crise, il faudra que tous les secteurs de la société et de l’économie se réunissent.

“Je crois qu’il y aura une autre crise”, a-t-il déclaré. “Elle sera plus importante. Nous devons commencer à nous y préparer dès maintenant”.

“Nous devons commencer cette coopération et cette compréhension très tôt, afin que lorsque la crise frappera, nous soyons en mesure d’y répondre efficacement”.

“Je pense que lorsque nous verrons la prochaine crise, elle sera plus rapide que ce que nous avons vu avec le COVID, le taux de croissance exponentielle sera beaucoup plus rapide, l’impact sera plus important, et par conséquent les implications économiques et sociales seront encore plus importantes.

“Je pense qu’il est vraiment important que nous ne sous-estimions pas la gravité d’une crise comme celle-ci – l’impact qu’elle pourrait avoir.

“Il faudra que tous les secteurs de la société et de l’économie se réunissent pour y faire face”, a ajouté M. Jurgens.

Le rapport Cyber Polygone 2020, ainsi que les sessions virtuelles enregistrées pendant la semaine de Davos fin janvier 2021, soulignent tous le besoin/désir de collaboration entre les secteurs public et privé – non seulement comme moyen d’éviter une cyber-pandémie – mais aussi pour remodeler l’ensemble de l’économie mondiale et réorganiser tous les aspects de la société dans le cadre d’une nouvelle forme de capitalisme participatif, issue du grand reset.

Tendances émergeant de l’exercice sur la pandémie numérique

Dans cet article, nous nous sommes penchés sur trois tendances qui se dégagent de Cyber Polygone 2020 :

  • Une plus grande consolidation des ressources et des collaborations entre les entreprises et les États
  • Un plan pour faire face aux fausses nouvelles, aux informations trompeuses et à la désinformation qui n’a pas encore été dévoilée
  • Une évolution vers l’identité numérique qui devra être sécurisée et protégée

Alors que ces observations de base ont été tirées de l’exercice de l’année dernière, le Cyber Polygone de cette année présentera de nouveaux défis dans lesquels les participants répondront à une menace différente – une attaque ciblée de la chaîne d’approvisionnement sur un écosystème d’entreprise en temps réel.

Si les résultats et les recommandations des précédentes simulations de pandémie sont une indication de ce qui pourrait arriver à la société, alors les conclusions et les politiques issues du Cyber Polygone 2021 pourraient avoir un impact sociétal réel dans un avenir très proche.

Par exemple, de nombreux scénarios joués dans les simulations fictives de pandémie soutenues par le FEM, Clade X (mai 2018) et Event 201 (octobre 2019), se sont réalisés par la suite, ainsi que plusieurs recommandations politiques pour faire face à la pandémie COVID-19.

Voir aussi : La pandémie de SPARS, 2025-2028

Ces scénarios ont été décrits :

  • Les gouvernements mettent en œuvre des mesures de confinement dans le monde entier
  • L’effondrement de nombreuses industries
  • Une méfiance croissante entre les gouvernements et les citoyens
  • Une plus grande adoption des technologies de surveillance biométrique
  • Censure des réseaux sociaux au nom de la lutte contre la désinformation
  • La volonté d’inonder les canaux de communication avec des sources “faisant autorité”
  • Chômage de masse
  • Émeutes dans les rues
  • Et bien plus encore !

Lorsque l’Organisation mondiale de la santé (OMS) a déclaré que le coronavirus était une pandémie le 11 mars 2020, les gouvernements du monde entier se sont retrouvés bloqués, ce qui a eu des effets dévastateurs sur l’économie avec des fermetures d’entreprises, des troubles civils qui ont explosé, une hausse du chômage, des saisies de logements à l’horizon et le plus grand transfert de richesse jamais enregistré dans l’histoire de l’humanité.

Cependant, nombre de ces scénarios étaient déjà prévus et pris en compte dans les simulations précédentes, et pourtant ils se sont tous réalisés.

Les conversations issues de Cyber Polygone 2021 se révéleront-elles aussi prophétiques pour le monde numérique que l’événement 201 et Clade X l’ont été pour le monde physique ?

Source : https://sociable.co/technology/prepping-cyber-pandemic-cyber-polygon-stage-supply-chain-attack-simulation/
Traduction par https://cv19.fr

Promesse non tenue: pendant la pandémie, les suppressions de lits d’hôpital se poursuivent

Les promesses d’Olivier Véran de ne plus réduire le nombre de lits d’hôpital se font attendre. Certaines suppressions sont toujours programmées. Avec les risques de troisième vague, l’hôpital public pourrait se retrouver de nouveau submergé. L’économiste Philippe Murer revient pour Sputnik sur cette «catastrophe comptable de réduction des coûts».

«On aurait pu espérer que ça se calme» avec «les erreurs» de la crise sanitaire, «mais non!», s’étrangle l’économiste Philippe Murer.

Car malgré l’engagement du gouvernement, qui promettait en décembre 2020 une sortie du «dogme de la réduction des lits», la logique de «rentabilité» et d’efficience semble perdurer au sein de l’hôpital public, en dépit de la menace constante de saturation.

11.093 nouvelles hospitalisations (avec 1.811 en réanimation) ont d’ailleurs été enregistrées sur les sept derniers jours. Ainsi Les Échos évoquaient-ils le 21 janvier le projet de fusion des hôpitaux Beaujon (Clichy) et Bichat (Paris), toujours en cours. Le futur hôpital Grand Paris-Nord, qui s’installera à Saint-Ouen d’ici 2028, devrait faire disparaître plus de 300 lits. De quoi faire bondir les soignants épuisés depuis le début de la crise sanitaire.

Des suppressions de lits sur tout le territoire

Le virage à 360 degrés annoncé par Olivier Véran faisait suite à la polémique ouverte au mois d’avril 2020 par le directeur de l’Agence régionale de santé du Grand-Est. Alors que la région était frappée de plein fouet par la première vague, ce dernier déclarait ne pas voir «de raison de remettre en cause» le plan de réorganisation de l’hôpital de Nancy. Celui-ci prévoyait la suppression de 174 lits et de 598 postes. Quelques jours plus tard, le haut fonctionnaire était limogé. Olivier Véran redressait la barre et promettait la suspension de «tous les plans de réorganisation».

Olivier Véran

© AFP 2020 BERTRAND GUAYOlivier Véran

Depuis, les promesses n’ont pas vraiment été tenues. À Nantes, Marseille ou Nancy, les projets en cours, déjà amorcés par les fameux plans Copermo, n’ont visiblement pas été entravés par la pandémie. Le mois dernier, Le Monde publiait un long article pour évoquer «l’inquiétude» des soignants et des syndicats devant la poursuite de ces restructurations d’hôpitaux.

«Il y a eu une suppression de lits de réanimation incroyable entre le début de la crise du Covid en mars 2020 et aujourd’hui, ajoute l’économiste Philippe Murer au micro de Sputnik. C’est vraiment catastrophique, alors qu’on a besoin de lits pour soigner les gens du Covid et […] ne pas détruire notre économie.»

Et l’économiste de rappeler l’information diffusée au mois d’octobre 2020 par Le Canard enchaîné, mentionnée récemment par l’économiste Gaël Giraud sur son compte Twitter. Le journal satirique avait révélé que le nombre de lits de réa en Île-de-France avait chuté depuis mars 2020, de 2.500 places –«très difficilement atteintes» soulignait le palmipède– à 1.700, soit une baisse de 30%.

Le @canardenchaine nous apprend que le nombre de lits de réa en Ile-de-France est passé de 2.500 en mars 2020 à … 1700 aujourd’hui. La bonne question est donc : pourquoi le gouvernement a-t-il délibérément laissé le nombre de lits diminuer ? 2/2 — Gaël Giraud (@GaelGiraud_CNRS) January 30, 2021

Réduire les coûts par l’ambulatoire

Selon Le Monde, si le ministère de la Santé est revenu de son «pur objectif financier d’économies», le voici toutefois qui opte pour une approche «projet par projet». Entendre par là que si des suppressions de lits sont toujours pertinentes, elles seront maintenues. L’option «ambulatoire» sera ainsi privilégiée quand elle le pourra. Cette prise en charge par l’hôpital sans hospitalisation justifie une diminution du nombre de lits disponibles et donc… une réduction des coûts. Un modèle critiqué par les soignants et profondément mis à mal par la surcharge des hôpitaux au moment de l’épidémie, comme à chaque grippe hivernale, d’ailleurs.

Petit Rappel pour les Médias Fake News : Chaque année, il n’y a plus assez de lit en réa, surtout en cette période de l’année ! Cette année nous n’avons pas encore vu des images de patients dans les brancards dans les couloirs alors que si positif on vous dit prenez 1 Doliprane ! pic.twitter.com/uFDAyazLh0 — SILVANO (@silvano_trotta) January 28, 2021

​Philippe Murer rappelle également une autre information, diffusée cette fois-ci par le collectif Inter-Urgences, association composée d’aides-soignants et d’infirmiers. Celui-ci partageait sur son compte Twitter le 28 janvier dernier une carte tirée d’une enquête du site Bastamag répertoriant l’ensemble des fermetures d’hôpitaux sur tout le territoire français.

La fermeture des lits à l’hôpital «est venue se fracasser sur l’épidémie».

La 3e vague semble inéluctable et les suppressions de lits continuent. En pleine pandémie les autorités sanitaires continuent de fermer des centaines de lits. pic.twitter.com/6Src5lFCfC — L’Inter-Urgences (@InterUrg) January 28, 2021

Le collectif n’en est pas à sa première dénonciation des conditions de travail et des économies dans l’hôpital public. Son action militante avait abouti à structurer la grève nationale de 2019. Face à la pression de la rue, Agnès Buzyn, à l’époque ministre de la Santé, annonçait un plan d’urgence au service des hôpitaux publics.

La catastrophe, c’est la faute à l’Europe?

Cette tendance à la réduction des coûts ne date pas d’hier. «65.000 lits ont été supprimés entre 2011 et 2018», ajoute Philippe Murer. Une logique «catastrophique» qui aura contraint l’État, devant la hausse des hospitalisations, à faire «l’erreur d’une gestion par le confinement.» L’économiste s’appuie sur l’étude parue au début du mois de janvier 2021 dans la prestigieuse revue European Journal of Clinical Investigation. Signée par l’éminent épidémiologiste de l’université de Stanford, le Pr John Loannidis, elle conclut à l’inefficacité du confinement.

[@andrebercoff] 🗣️@raoult_didier “John Ioannidis, grand épidémiologiste mondial le dit, les contrôles sociaux mis en place ne servent à rien : le confinement, la fermeture des #restaurants etc. On se contamine en famille à la maison, pas dans la rue”

📺https://t.co/OU0dSaeXsg pic.twitter.com/uRKPixh7Pf — Sud Radio (@SudRadio) January 29, 2021

​Une erreur qui aura coûté la bagatelle de «400 milliards d’euros» à la France, estime Philippe Murer, qui dénonce cette «caste stupide de financiers et de comptables qui nous dirige!» Une caste qui n’aurait fait que respecter «les ordres de l’Union européenne», en quête «de petites économies au jour le jour, de centaines de millions d’euros par an.»

«Il y a eu 63 demandes de l’Union européenne dans les dernières années pour supprimer des dépenses de santé dans tous les pays d’Europe, conclut notre interlocuteur. Pour elle, tout ce qui est privatisé devient un marché privé européen. C’est une vision ultralibérale des choses, selon laquelle le privé est toujours mieux que le public.»

Source : https://fr.sputniknews.com/france/202102021045167132-promesse-non-tenue-pendant-la-pandemie-les-suppressions-de-lits-dhopital-se-poursuivent/

Les écoles de Las Vegas forcées de rouvrir en raison de la vague de suicides d’étudiants

Une vague de suicides d’étudiants à Las Vegas a poussé le district scolaire du comté de Clark à rouvrir les écoles dès que possible, selon le NYTimes.

En décembre, dix-huit élèves du district s’étaient suicidés ; un système d’alerte précoce de santé mentale intégré dans les ordinateurs et les tablettes distribuées aux élèves pour l’apprentissage à distance a reçu 3 100 alertes depuis que les écoles ont fermé leurs portes en mars dernier.

“Quand nous avons commencé à voir la hausse du nombre d’enfants qui se suicidaient, nous avons su qu’il ne suffisait plus de regarder les chiffres de Covid”, a déclaré Jesus Jara, le directeur du comté de Clark.

“Nous devons trouver un moyen de mettre la main sur nos enfants, de les voir, de les regarder. Ils doivent commencer à voir du mouvement, de l’espoir”, a déclaré Jara.

Les efforts déployés pour atténuer la propagation de COVID-19 à travers le pays ont conduit à des changements drastiques dans la façon dont les enfants et les adolescents apprennent et socialisent.

Les données gouvernementales montrent une augmentation de 24 % du nombre d’enfants arrivés aux urgences avec des problèmes de santé mentale de la mi-mars à la mi-octobre, par rapport à la même période en 2019.

Dans tout le pays, des dizaines de millions d’étudiants ont été jetés dans un nouvel environnement d’apprentissage à distance qui a entraîné l’annulation de nombreuses activités extrascolaires. Les espaces de loisirs ont fermé, les sports ont été annulés et les sorties ont été remplacées par des appels Zoom, ce qui a entraîné le développement de problèmes mentaux chez de nombreux enfants, en particulier dans le comté de Clark.

Les administrateurs du comté de Clark ont fait installer un système d’alerte GoGuardian Beacon sur chaque appareil remis aux élèves après le sixième suicide d’élève l’année dernière. Le système a alerté les administrateurs de plus de 3 100 cas où un élève a consulté des documents liés au suicide entre juin et octobre.

Dans un cas, un garçon de 12 ans a cherché “comment faire un noeud coulant” sur son iPad”. Les administrateurs ont rapidement contacté les parents du garçon alors qu’il était sur le point de se pendre.

Les alertes ont été si bouleversantes pour Jara qu’il ne dort plus près de son téléphone.

“Je ne peux plus recevoir ces alertes”, a déclaré Jara. “Je n’ai plus de mots à dire à ces familles. Je crois en Dieu, mais je ne peux pas m’empêcher de me poser des questions : Est-ce que je fais tout mon possible pour ouvrir nos écoles ?”

Le Dr Anthony Fauci a demandé que les écoles du pays rouvrent en toute sécurité.

Une conséquence indirecte de la pandémie et le fait de forcer les enfants à apprendre à la maison ont contribué à une augmentation des problèmes de santé mentale et des suicides au sein de la future génération américaine.

Source : https://www.zerohedge.com/medical/las-vegas-schools-forced-reopen-amid-rash-student-suicides
Traduction par https://cv19.fr

Poutine lève les restrictions Covid

par Boris Guenadevitch Karpov.

Allant à contre-courant de la paranoïa des gouvernements occidentaux, Vladimir Poutine a annoncé ce jour le retour à la normale en Russie :

« En Russie, la situation avec le coronavirus se stabilise ; les restrictions imposées en lien avec la « pandémie » peuvent être progressivement levées. En général, la situation épidémiologique dans le pays se stabilise progressivement. Ce matin, j’ai écouté les rapports : nous avons déjà le nombre de guéris supérieur au nombre de malades. Le nombre de personnes infectées diminue, il est à moins de 20 pour mille. Cela permet de supprimer soigneusement les restrictions imposées ».

Actuellement dans la plupart des régions de la Fédération de Russie il y a déjà très peu de restrictions depuis l’été dernier, comparativement aux pays occidentaux : Tous les services et commerces fonctionnent (bars et restaurants doivent dans plusieurs régions fermer à 23 heures… en théorie. En pratique, beaucoup ne ferment qu’à l’aube…). Les seules limitations sont l’obligation (ici aussi très théorique) du masque dans les transports et magasins, et la limitation à 50% du taux d’occupation des cinémas, musées etc. Par ailleurs la population en grande partie ne suit que très peu les consignes stupides : Le masque est peu porté, ou alors sous le menton. Quand aux « distances sociales »… Voici une photo prise il y a quelques jours dans le métro de Moscou…

La portée de la déclaration de Vladimir Poutine est en fait très politique : Elle montre au clan des globalistes en Russie, mené par le maire de Moscou qui désire renforcer les mesures pour s’aligner sur les pays occidentaux, que son petit jeu est terminé. En août, c’est déjà Vladimir Poutine qui avait ordonné au maire de Moscou de lever la quarantaine (Le maire avait reçu un coup de téléphone en pleine réunion pour préparer l’annonce de la poursuite de la quarantaine et avait déjà commencé à faire envoyer des SMS pour en informer la population. Selon un témoin, le maire n’a rien dit durant 2 à 3 minutes, et à la fin de la communication a déclaré que la quarantaine était levée). La semaine dernière c’est encore le président qui a ordonné au maire de Moscou de cesser l’enseignement « à distance » que celui-ci avait mis en place en octobre pour une grande partie des élèves. Aujourd’hui, le président Poutine déclare donc, au plan national, que les choses ont assez duré.

S’il y a assurément une justification électorale à cette décision, par la chute de popularité du maire de Moscou à 80% de mécontents qui se traduit par la chute de popularité de Poutine avec un énorme 40% de mécontents), il semble clair, alors que les pays occidentaux rivalisent de paranoïa pour savoir qui enfermera le plus durement et longuement sa population, que Vladimir Poutine met la Russie en dehors du plan globaliste. On rappellera par ailleurs les mesures nouvelles que la Russie a inscrites dans sa Constitution (par exemple le mariage = Homme plus Femme exclusivement, la réaffirmation de la foi en Dieu, la prédominance des lois Russes sur les lois internationales, etc) qui montrent clairement le chemin choisi, aux antipodes du projet de société mondialiste.

Le hold-up électoral réalisé par Biden et ses complices aux États-Unis va rapidement entraîner l’Europe de l’Ouest dans une globalisation à marche forcée. Macron a d’ailleurs fait allégeance à Biden lors de leur premier entretien téléphonique hier. La Russie s’affirmera alors comme un oasis souverain dans un monde fou. C’est d’ailleurs pour éviter cela que les globalistes font le forcing avec les tentatives de soulèvement fomentées par la « 5ème colonne » menée par Navalny et quelques oligarques.

Mais, comme le disait ici-même Konstantin Sergueïevitch : « la Russie a les moyens humains, financiers et militaires, de tracer sa voie quelles que soient les réactions des globalistes ». Dans ce même article, Konstantin Sergueïevitch écrit : « Faute de réaction rapide, demain ou après-demain, le pire est déjà programmé ». La déclaration de Vladimir Poutine ce jour sur la fin de la folie autour du covid montre qu’il y a une réaction, qui devrait être suivie d’autres dans les semaines à venir.

source : https://boriskarpov.tvs24.ru

via https://rusreinfo.ru/fr/

Epidémiologie des Eaux Usées

La surveillance des eaux usées pourrait constituer un signal précoce pour aider à la gestion de la pandémie. Actuellement, diverses études ont détecté de l’ARN du SRAS-CoV-2 dans les eaux usées dans le monde entier avec une grande sensibilité, c’est-à-dire quelques jours seulement après l’identification du premier cas humain de Covid-19. La surveillance des eaux usées fournit un échantillon impartial de la population infectée, y compris les individus asymptomatiques.

Résumé à partir de l’article du Dr Bénédicte Helfer publié dans France Soir le 20 octobre 2020 :

http://www.francesoir.fr/societe-sante/le-developpement-de-lepidemiologie-des-eaux-usees-un-nouvel-outil-de-veille-sanitaire

La surveillance des eaux usées pourrait constituer un signal précoce pour aider à la gestion de la pandémie. En effet, outre une prophylaxie efficace en cas de préexposition, ou des traitements thérapeutiques, l’outil le plus important est la capacité d’identifier rapidement les personnes infectées et potentiellement contagieuses. L’anxiété de la population concernant l’augmentation des cas détectés, et l’interprétation qu’il faut en avoir pourraient être résolues par un nouvel outil épidémiologique développé et affiné par des scientifiques de l’environnement au cours des 20 dernières années : L’épidémiologie des eaux usées.

Mise en place dans le cadre du réseau national de surveillance OBEPINE (OBservatoire EPIdémiologique daNs les Eaux usées) qui s’appuie sur 7 équipes de recherche affiliées à 9 tutelles, cette nouvelle approche permettrait de fournir une précieuse aide à la décision des politiques publiques [1, 2]. OBEPINE a ainsi une vocation opérationnelle, (1) soit à l’échelle d’un territoire (selon la taille de la station ; des études ont été réalisées sur l’Ile d’Yeu en Aout par exemple), (2) soit en développant des stratégies d’analyse en remontant les réseaux d’assainissement (développement de capteurs intégrés, analyse dans les collecteurs par quartier, ce qui est fait sous Paris intra muros depuis le printemps). En parallèle de ce réseau national, l’unité COMETE (Covid-19 Marseille Environment Testing & Expertise) initiée par le BMPM (bataillon de marins-pompiers de Marseille) analyse quant à elle les eaux usées collectées sur Marseille.

Cette approche pourrait ainsi venir compléter les différents indicateurs actuellement utilisés pour évaluer le niveau de circulation du virus dans les populations qui sont :

  • Les données cliniques de la maladie qui reste difficile à détecter en raison de signes non-spécifiques le plus souvent.
  • Les tests RT-PCR, couteux, qui posent actuellement des problèmes de sensibilité et spécificité ne permettant pas d’utiliser cet indicateur de façon fiable et robuste [3].
  • L’incidence (nombre de tests positifs sur nombre de tests totaux) qui ne détecte que les cas dans la population testée, et pas dans la population générale
  • Le nombre quotidien de nouvelles hospitalisations, entrées en réanimation et décès

La surveillance des eaux usées a été une stratégie couronnée de succès pour suivre les marqueurs chimiques et biologiques de l’activité humaine [4, 5, 6]. Actuellement, diverses études ont détecté de l’ARN du SRAS-CoV-2 dans les eaux usées dans le monde entier avec une grande sensibilité [7, 8, 9, 10, 11, 12, 13, 14, 15] c’est-à-dire quelques jours seulement après l’identification du premier cas humain de Covid-19 dans un pays [16]. « Depuis le 20 juin, la circulation du SARS-CoV-2 a repris progressivement : on a vu réapparaître des charges virales plus importantes dans les eaux usées, mais à un rythme beaucoup plus lent que lors de la première vague », observe auprès du « Quotidien » le Pr Vincent Maréchal, virologue à Sorbonne Université, initiateur du réseau OBEPINE (consortium de recherche soutenu par le Comité Analyse Recherche et Expertise (CARE) mis en place par le Président Macron qui vise à promouvoir l’analyse des eaux usées pour y détecter d’éventuelles traces de virus SARS-Cov-2 comme outil de surveillance épidémiologique dans le cadre d’un plan de lutte intégrée contre l’épidémie de Covid-19.) Ces résultats démontrent pour la première fois que la quantification du virus permet une analyse fine de la dynamique virale [15].

Cette technique agrège les informations sur la santé au niveau de la totalité de la population. En outre, la surveillance des eaux usées (c’est-à-dire la surveillance des maladies via les effluents humains) fournit un échantillon impartial de la population infectée, y compris les individus asymptomatiques.

Les intérêts de la détection du SARS-CoV-2 dans les eaux usées sont multiples :

  • Approche complémentaire à la surveillance épidémiologique conventionnelle.
  • Diminution de la demande de tests individuels
  • Détection en temps réel de l’évolution de l’épidémie
  • Aide à la décision en matière de politiques publiques sanitaires.
  • Détermination de la population non infectée
  • Surveillance de la variation génotypique du SARS-CoV-2.
  • Renforcement de la transparence et désamorçage des controverses éventuelles.
  • Amélioration des connaissances en termes d’épidémiologie des maladies infectieuses.

La surveillance des eaux usées représente un complément précieux aux approches cliniques. Relativement peu coûteuse et facile à collecter, la surveillance des eaux usées pourrait constituer un signal précoce pour aider à la gestion de la pandémie, et pourrait venir en complément des diagnostics sanitaires individuels [15] y compris dans les pays à faibles revenus.

A Retenir

  • La surveillance des eaux usées permet de détecter précocement de l’ARN du SRAS-CoV-2 dans les eaux usées
  • La surveillance des eaux usées fournit les informations sur la santé de la totalité de la population, indépendante des biais associés à la notification des cas par test individuel RT-PCR.
  • Relativement peu coûteuse et facile à collecter la surveillance des eaux usées pourrait fournir une précieuse aide à la décision des politiques publiques.

Références

[1] http://www.francesoir.fr/societe-sante/le-developpement-de-lepidemiologie-des-eaux-usees-un-nouvel-outil-de-veille-sanitaire

[2] https://youtu.be/ToxeSJcIpcw

[3] https://www.lemediatv.fr/emissions/tout-peut-arriver/tests-covid-19-revelations-sur-un-nouveau-scandale-sanitaire-dEdPMI_qTcuDGwxrmVU7Sw

[4] Sims, Natalie, and Barbara Kasprzyk-Hordern. “Future perspectives of wastewater-based epidemiology: Monitoring infectious disease spread and resistance to the community level.” Environment international vol. 139 (2020),  https://doi.org/10.1016/j.envint.2020.105689

[5] de Oliveira M, Frihling BEF, Velasques J, et al. Pharmaceuticals residues and xenobiotics contaminants: Occurrence, analytical techniques and sustainable alternatives for wastewater treatment. The Science of the Total Environment. (2020);705:135568. https://doi.org/10.1016/j.scitotenv.2019.135568.

[6] Maria Lorenzo, Yolanda Picó, Wastewater-based epidemiology: current status and future prospects, Current Opinion in Environmental Science & Health, Volume 9, (2019), Pages 77-84, https://doi.org/10.1016/j.coesh.2019.05.007.

[7] Ahmed W, Angel N, Edson J, Bibby K, Bivins A, O’Brien JW, Choi PM, Kitajima M, Simpson SL, Li J, Tscharke B, Verhagen R, Smith WJM, Zaugg J, Dierens L, Hugenholtz P, Thomas KV, Mueller JF. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci Total Environ. 2020 august;728:138764. https://doi.org/10.1016/j.scitotenv.2020.138764

[8] Lodder W, de Roda Husman AM. SARS-CoV-2 in wastewater: potential health risk, but also data source. Lancet Gastroenterol Hepatol. 2020 Jun;5(6):533-534. https://doi.org/10.1016/S2468-1253(20)30087-X

[9] Sara Giordana Rimoldi, Fabrizio Stefani, Anna Gigantiello, Stefano Polesello, Francesco Comandatore, Davide Mileto, Mafalda Maresca, Concetta Longobardi, Alessandro Mancon, Francesca Romeri, Cristina Pagani, Francesca Cappelli, Claudio Roscioli, Lorenzo Moja, Maria Rita Gismondo, Franco Salerno, Presence and infectivity of SARS-CoV-2 virus in wastewaters and rivers, Science of The Total Environment, Volume 744, (2020), 140911, https://doi.org/10.1016/j.scitotenv.2020.140911

[10] Fuqing Wu, Jianbo Zhang, Amy Xiao, Xiaoqiong Gu, Wei Lin Lee, Federica Armas, Kathryn Kauffman, William Hanage, Mariana Matus, Newsha Ghaeli, Noriko Endo, Claire Duvallet, Mathilde Poyet, Katya Moniz, Alex D. Washburne, Timothy B. Erickson, Peter R. Chai, Janelle Thompson, Eric, SARS-CoV-2 Titers in Wastewater Are Higher than Expected from Clinically Confirmed Cases,  J. Alm.mSystems Jul 2020, 5 (4) e00614-20; https://doi.org/10.1128/mSystems.00614-20

[11]  A.Nemudryi, A. Nemudraia, T. Wiegand, K. Surya, M. Buyukyoruk, C. Chica, K.K. Vanderwood, R. Wilkinson, B. Wiedenheft, Temporal Detection and Phylogenetic Assessment of SARS-CoV-2 in Municipal Wastewater, Volume 1, ISSUE 6, 100098, September 22, 2020  https://doi.org/10.1016/j.xcrm.2020.100098

[12] Walter Randazzo, Enric Cuevas-Ferrando, Rafael Sanjuán, Pilar Domingo-Calap, Gloria Sánchez, Metropolitan wastewater analysis for COVID-19 epidemiological surveillance, International Journal of Hygiene and Environmental Health, Volume 230, 2020, 113621, https://doi.org/10.1016/j.ijheh.2020.113621

[13] Randazzo, Walter et al. “SARS-CoV-2 RNA in wastewater anticipated COVID-19 occurrence in a low prevalence area.” Water research vol. 181 (2020): 115942. https://doi.org/10.1016/j.watres.2020.115942

[14] Christa Lesté-Lasserre, Coronavirus found in Paris sewage points to early warning system, Science, avr 20, https://www.sciencemag.org/news/2020/04/coronavirus-found-paris-sewage-points-early-warning-system

[15] Sebastien Wurtzer, Vincent Marechal, Jean-Marie Mouchel, Yvon Maday, Remy Teyssou, Elise Richard, Jean Luc Almayrac, Laurent Moulin, Evaluation of lockdown impact on SARS-CoV-2 dynamics through viral genome quantification in Paris wastewaters, medRxiv 2020   https://doi.org/10.1101/2020.04.12.20062679

[16] Gertjan Medema, Leo Heijnen, Goffe Elsinga, Ronald Italiaander, and Anke Brouwer, Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands, Environmental Science & Technology Letters 2020 7 (7), 511-516, https://doi.org/10.1021/acs.estlett.0c00357

Source : https://reinfocovid.fr/science/epidemiologie-des-eaux-usees/

Covid-19 et Sars-Cov-2 – Les preuves d’une fraude globale ?

par M.K. Scarlett.

S’interroger sur le fait de savoir si le Sras-CoV-2 a été ou pas vraiment « isolé » peut sembler pertinent, d’autant que la généticienne Alexandra Henrion-Caude se pose la même question.

L’article qui suit et les informations qu’il contient rend compte de certains faits qui posent question et qui sont par ailleurs peu débattus. Ces éléments ne suffiront sans doute pas à trancher la question, mais ils offrent, considérés dans leur ensemble, des éléments de réponses possibles, qui ouvrent eux-mêmes sur d’autres questionnements. Le tout étant par ailleurs parfois un peu technique, des explications supplémentaires portant sur des détails particuliers seront apportées au lecteur.

Toutefois, et pour mettre les choses en perspective dans le contexte qui est le nôtre aujourd’hui, à savoir que nous avons affaire à des psychopathes — et à des suiveurs autoritaristes souvent corrompus, au rang desquels se trouvent des scientifiques — qui usent de sophisme pour nous raconter une histoire (celle de leur pseudo-réalité), voici un extrait de l’ouvrage de Josef Pieper, Abus de langage, Abus de pouvoir :

« [les sophistes sont des] maîtres dans l’art de déformer les mots, grassement payés et acclamés par les foules […] capables de faire l’éloge d’une chose mauvaise en la faisant apparaître comme bonne et qui [savent] avec maestria transformer le blanc en noir. [la sophistique est] un danger et une menace qui frappent la vie de l’esprit et celle de la société à toutes les époques. […] les sophistes, doués d’une énorme sensibilité pour les nuances du langage et d’une dose extrême d’intelligence formelle, cultivent le mot, érigent et parfaissent l’usage du mot en art — et […] ce faisant, ils corrompent en même temps le sens et la dignité du mot. [Il est essentiel] de reconnaître que quelque chose peut être magnifiquement fait, représenté, mis en scène, filmé brillamment et cependant être en même temps fondamentalement et essentiellement faux, et pas seulement faux, mais aussi mauvais, inférieur, lamentable, honteux, funeste, vil — et pourtant magnifiquement réalisé ! […] la difficulté à reconnaître les sophistes fait partie du succès de ces derniers. »

On retrouve cet abus de langage au sein d’une mauvaise science devenue religieusement universelle dans laquelle il existe

« un phénomène de « corruption systémique », une entreprise de manipulation généralisée permettant de ne pas avoir besoin de soudoyer un grand nombre de personnes. La manipulation globale permet que des foules d’acteurs de bonne foi y participent en toute ignorance de cause. »

Voici donc la traduction de l’article écrit par Iain Davis sur son site Web In This Together.

*

Le Covid-19, et les réponses gouvernementales qui ont suivi, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’aucune preuve n’existe pour démontrer qu’un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis prêt à être corrigé. Cependant, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur comité consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les sondes et les amorces génétiques utilisées dans les tests RT-PCR pour identifier le Sras-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire de même.

D-Salud-Discovery indique qu’il n’existe aucun test capable d’identifier le Sras-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du Covid-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel du Covid-19 est une supercherie. De toute évidence, il n’existe aucun fondement scientifique dans aucune des parties de ce récit.

Si ces affirmations sont exactes, nous pouvons déclarer qu’il n’existe pas de preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est celles des ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Note de MKS

Puisque l’auteur parle de parasites, voici quatre articles qui pourraient permettre au lecteur de creuser un peu plus :

Qu’ont-ils identifié exactement ?

L’Organisation mondiale de la santé (OMS) a classifié la maladie Covid-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de Covid-19 le 11 mars 2020.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le Sras-CoV et le Mers-CoV) par un séquençage de nouvelle génération à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus du Sras-CoV-2 est à l’origine du Covid-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau coronavirus 2019-nCov — Rapport de situation n° 1 », ils déclarent que :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 […] Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques. »

Ces deux déclarations de l’OMS suggèrent clairement que le virus Sras-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les villages aux quatre coins du globe. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause le Covid-19.

Pourtant, l’OMS affirme également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir d’« informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du virus dit Sras-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines en épi [ou protéine Spike – NdT] contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Des virologues affirment qu’il n’est pas possible d’« isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes [et donc in vivo, et non in vitro dans lequel il est sorti de son environnement et ne peut par conséquent pas se comporter de la même manière – NdT]. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries — qui sont des organismes vivants. Par contre, ce que les virologues observent dans des cultures cellulaires, ce sont les effets cytopathogènes du virus qui provoquent la mutation et la dégradation des cellules.

Lorsque les chercheurs chinois ont au départ séquencé le génome complet du Sras-CoV-2, ils ont observé un effet cytopathogène dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire simienne immortalisée et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Note de MKS

Une lignée cellulaire immortalisée est une lignée qui a échappé à la senescence cellulaire (par un procédé chimique) et qui peut donc se diviser indéfiniment in vitro. Les cellules Vero sont une lignée cellulaire utilisée pour les cultures cellulaires. Les cellules Vero E6 sont un clone de la souche 76, elle-même découverte en 1968. La lignée de cellules Vero a été isolée et établie à partir de rein de singe vert adulte d’Afrique (Certopithecus aethiops) en mars 1962 par Y. Yasumura et Y. Kawakita à l’université de Chiba au Japon. Source

Au cœur de l’histoire officielle du Sras-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, [qui serait – NdT] capable de combler le fossé entre les espèces, des animaux aux humains. Lorsque des scientifiques du CDC aux États-Unis ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du Sras-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, y compris les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0), et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules simiennes]… Aucun effet cytopathogène n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules simiennes] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le Sras-CoV-2. »

Le CDC n’a observé aucun effet cytopathogène dans les cellules humaines. Ils n’ont trouvé aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Que le Sras-CoV-2 soit un virus humain capable de provoquer une maladie généralisée est loin d’être évident. Il se peut même qu’il n’existe pas physiquement. Ne serait-ce alors rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Note de MKS

Notez que le Sras-CoV-2 imagé ci-dessus posséderait une protéine de surface (Spike) présentant une différence notable par rapport à d’autres coronavirus génétiquement proches. Ou plus exactement, le site de clivage de la protéine Spike du Sras-CoV-2 posséderait un insert (un fragment de peptide en plus) de quatre acides aminées, absent des protéines Spike de Sras-CoV. Source

À propos de l’origine soi-disant zoonotique, Judy Mikovits a déclaré ce qui suit : […] Il n’a pas pu apparaître de façon naturelle. Le virus n’a pas pu passer directement à l’homme depuis une chauve-souris achetée au marché par un individu. Ça ne fonctionne pas ainsi. Il s’agit d’une évolution virale accélérée. S’il s’agissait d’un phénomène naturel, il faudrait jusqu’à 800 ans pour que le virus évolue de cette manière.

Rappelons aussi que le Dr Pekova suggérait dès avril dernier que le séquençage du Sras-CoV-2 « semble plutôt anormal, et qu’une restructuration aussi importante a peu de chances de se produire dans la nature, sans intervention humaine ».

Voyage de découverte

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le premier génome complet du Sras-CoV-2 (MN908947.1). Ce séquençage a été mis à jour à de nombreuses reprises. Toutefois, MN908947.1 fut le premier à avoir décrit le prétendu agent étiologique du Sras-Cov-2, à savoir le Covid-19.

Toutes les revendications, les tests, les traitements, les statistiques, le développement de vaccins et les politiques qui en découlent sont basés sur ce séquençage. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit du Covid-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du Sras-CoV-2 en faisant correspondre des fragments trouvés dans les échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1 % avec les coronavirus Sras (Sras-Cov). Ils ont utilisé l’assemblage de novo et la PCR ciblée, et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6 % au Sras-CoV.

Ils ont dû utiliser un assemblage de novo parce qu’ils n’avaient aucune connaissance préalable de la séquence ou de l’ordre corrects de ces fragments. En clair, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

Note de MKS

L’assemblage de novo est une technique de séquençage d’un génome inconnu. Il nécessite l’assemblage d’un très grand nombre de petites séquences de ce même génome. Il nécessite aussi un génome de référence (s’il en existe un) afin de positionner (par comparaison) les séquences obtenues. L’assemblage de novo nécessite pour reconstituer un génome complet des programmes bioinformatiques de pointe. Source

Avant de poursuivre, il est nécessaire de comprendre le principe du test PCR et l’usage qui en est fait dans le cadre de la « crise-Covid-19 ».

Il s’agit en tout premier lieu d’un procédé d’amplification moléculaire qui mime le processus naturel de synthèse de l’ADN.

La PCR ciblée est une technique de réplication ciblée in vitro — ou encore ACP pour « amplification en chaîne par polymérase ». Le principe consiste à obtenir, à partir d’un échantillon complexe et peu abondant, d’importantes quantités d’un fragment d’ADN spécifique et de longueur définie, dont l’ordre de grandeur à retenir est celui du million de copies en quelques heures, ce qui est généralement suffisant pour une utilisation ultérieure. Source

Pour Kary Mullis, l’inventeur de la technique PCR qui lui a permis de gagner le prix Nobel de chimie en 1993, cet examen était avant tout qualitatif et destiné à répondre à la question : l’élément est là, oui ou non, mais il n’était pas du tout destiné à le quantifier, et donc, certainement pas conçu pour poser un diagnostic :

« C’est un procédé qui est utilisé pour faire beaucoup de choses à partir de quelque chose. Ça ne dit pas si vous êtes malade. Ça ne dit pas que la chose que vous avez contractée va réellement vous nuire… »

Voir aussi l’avis d’Alexandra-Henrion Caude sur le sujet : « Covid-19, gestion sanitaire, tests PCR, vaccins ARN, stress — Interview avec Alexandra Henrion-Caude ».

Ces cycles d’amplification successifs, peuvent aller, voire dépassent 40. Plus on augmente le nombre de cycles, plus on sera certain de trouver plus de quelque chose, et même une très faible charge virale donnera un résultat positif — à quelque chose qui ressemble à un coronavirus, puisque ces tests détectent des particules virales, des séquences génétiques, mais PAS le virus en entier. Selon Bernard La Scola dans une étude publiée dans la revue European Journal of Clinical Microbiology & Infectious Diseases, « il n’est plus possible de cultiver du virus in vitro lorsque le cycle d’amplification dépasse 34 ». Multiplier ces cycles nécessitent en outre de nombreuses étapes complexes et sujettes à des erreurs, des fautes de stérilité et des contaminations.

Un article pré-publié sur le site medRxiv en juillet 2020 en fait la synthèse :

« Aucune culture virale n’a été obtenue à partir d’échantillons […] avec des cycles d’amplification supérieurs à 24 ou 34, indiquent les chercheurs. La possibilité de cultiver du virus décroit lorsque les cycles d’amplification augmentent. »

Par ailleurs, et histoire de rajouter à la confusion, le nombre de cycles n’est pas le même d’un pays l’autre, voire d’un laboratoire à l’autre au sein d’un même pays…

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome déjà connu et publié du coronavirus du Sras (Sras-CoV). Malheureusement, la précision du génome original du coronavirus du Sras n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié cinquante patients atteints du syndrome respiratoire aigu sévère (Sras). Ils ont prélevé des échantillons sur deux de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

À partir du matériel génétique trouvé, ils ont créé trente clones. Tandis qu’ils n’ont pu trouver aucune preuve d’un autre virus connu, ils ont toutefois trouvé dans un seul de ces échantillons clonés des séquences génétiques d’« origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57 % de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggéraient la découverte d’un nouveau virus du Sras-CoV (toute nouvelle découverte étant par ailleurs considérée par les scientifiques comme une ambroisie), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour détecter le nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du Sras, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie. »

Note de MKS

Bien que l’auteur l’aborde partiellement plus loin, il est utile d’expliquer rapidement ce qu’est une « amorce » (et une sonde) dans le langage de la recherche génétique, voyons les quatre étapes du test PCR (après le prélèvement).

  • La première étape est celle de la dénaturation réalisée à une température de 95°C, l’ADN double-brin est séparé en ses deux brins d’ADN constitutifs ;
  • La deuxième étape est celle de l’hybridation lors de laquelle un oligonucléotide (la sonde) s’apparie à la séquence d’ADN qui lui est complémentaire ;
  • La troisième étape est celle de la polymérisation dans laquelle un deuxième oligonucléotide, l’amorce, s’hybride en amont, à quelques paires de bases de distance de la sonde ;
  • La quatrième étape est celle de l’émission de fluorescence qui permet d’éventuellement détecter et quantifier un signal fluorescent à même de prouver la présence de ce qui est recherché.

Pour plus de détails, consultez cet article assez simplifié d’où j’ai tiré ce qui précède, ou celui-ci, bien plus fourni. Selon eurofins, les étapes 1 à 4 sont répétées de 35 à 50 fois. Un must !

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs à ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus Sras-CoV. La question n’a pas été posée.

Ce supposé virus ne présentait qu’une correspondance de séquence de 57 % avec un coronavirus prétendument connu. Les 43 % restants étaient juste « là ». Les données séquencées ont été produites et enregistrées en tant que nouveau génome auprès de la GenBank sous le numéro d’accès AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une séquence correspondant à 79,6 % à AY274119 et l’ont donc qualifiée de nouvelle souche de Sras-CoV (2019-nCoV — finalement rebaptisée Sras-CoV-2). Personne n’avait, à aucun moment de ce processus, produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Ils n’ont rien isolé

Les scientifiques sont très agacés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. La raison en est que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus Sras-CoV-2. Ce dont nous disposons, en revanche, c’est d’un génome complet et, comme nous sommes sur le point de le découvrir, celui-ci n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du Sras-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

Note de MKS

En préambule des réponses retranscrites ci-dessous, les auteurs de l’article stipule ce qui suit :

« Et comme les tests PCR sont calibrés pour les séquences de gènes (dans ce cas-ci les séquences d’ARN car on pense que le Sras-CoV-2 est un virus à ARN), nous devons savoir que ces extraits de gènes font partie du virus recherché. Et pour le savoir, il faut procéder à une isolation et une purification correctes du virus présumé.

C’est pourquoi nous avons demandé aux équipes scientifiques [auteurs] des documents pertinents auxquels il est fait référence dans le contexte du Sras-CoV-2 de prouver si les clichés au microscope électronique présentés dans leurs expériences in vitro montrent des virus purifiés. »

Voici les réponses de ces scientifiques :

Study 1: Leo L. M. Poon; Malik Peiris. « Emergence of a novel human coronavirus threatening human health » Nature Medicine, March 2020
Replying Author: Malik Peiris
Date: May 12, 2020
Answer: « The image is the virus budding from an infected cell. It is not purified virus. » [L’image est le virus bourgeonnant d’une cellule infectée. Ce n’est pas un virus purifié.]

Study 2: Myung-Guk Han et al. « Identification of Coronavirus Isolated from a Patient in Korea with COVID-19 », Osong Public Health and Research Perspectives, February 2020
Replying Author: Myung-Guk Han
Date: May 6, 2020
Answer: « We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells. » [Nous n’avons pas pu estimer le degré de purification car nous ne purifions pas et ne concentrons pas le virus cultivé dans les cellules.]

Study 3: Wan Beom Park et al. « Virus Isolation from the First Patient with SARS-CoV-2 in Korea », Journal of Korean Medical Science, February 24, 2020
Replying Author: Wan Beom Park
Date: March 19, 2020
Answer: « We did not obtain an electron micrograph showing the degree of purification. » [Nous n’avons pas obtenu de micrographie électronique montrant le degré de purification.]

Study 4: Na Zhu et al., « A Novel Coronavirus from Patients with Pneumonia in China », 2019, New England Journal of Medicine, February 20, 2020
Replying Author: Wenjie Tan
Date: March 18, 2020
Answer: « [We show] an image of sedimented virus particles, not purified ones. » [[Nous montrons] une image de particules de virus sédimentées, et non pas purifiées.]

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus Sras-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré [le 29 janvier 2020] :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic. »

Ceci explique pourquoi le gouvernement australien a déclaré [le 4 décembre 2020] :

« La fiabilité des tests Covid-19 est incertaine en raison de la base de preuves limitée… Il existe peu de preuves disponibles pour évaluer la précision et l’utilité clinique des tests Covid-19 disponibles. »

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus Covid-19 a été isolé. »

Ils n’ont, à ce jour, pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a présenté aux autorités nationales en charge de la santé publique en Angleterre [PHE en anglais – NdT] une requête en vertu de la loi sur la liberté de l’information. Il leur a demandé de lui fournir leurs dossiers décrivant la façon dont le virus du Sras-COV-2 avait été isolé. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande. »

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande. »

Aux États-Unis, le Panel de diagnostic RT-PCR du Centre de contrôle des maladies (CDC) indique ce qui suit :

« […] Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible […] La détection de l’ARN viral pourrait ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques. »

Dans leur dernière mise à jour du 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de Covid-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le Sras-CoV-2 est présent ou cause le Covid-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons nous contenter d’images de choses dont nous savons qu’elles pourraient être autre chose et de séquences génétiques (qui pourraient être n’importe quoi d’autre) comme autant de preuves concluantes que ce virus, et la maladie qu’il est censé causer, sont réels.

Tester en vain

L’OMS, ainsi que tous les gouvernements, les think-thank, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel du Covid-19, affirment que le Sras-CoV-2 provoque le Covid-19. Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du Sras-CoV-2 a été publié. Il relève du domaine public.

Au sein du génome du Sras-CoV-2, des séquences génétiques clés auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment des quatre suivantes :

  • Le gène de l’ARN polymérase ARN-dépendante (Rd-Rp) — Il permet à l’ARN du Sras-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales malades du Covid-19 ;
  • Le gène S (ORF2) — Cette glycoprotéine forme le pic [Spike – NdT] à la surface du virion du Sras-CoV-2 qui est censé faciliter la liaison du Sras-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée ;
  • Le gène E (ORF1ab) — C’est une petite protéine membranaire utilisée dans l’assemblage du virus ;
  • Le gène N (ORF9a) — Il s’agit du gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre accessible au public des amorces et des sondes RT-PCR utilisées pour tester le Sras-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins anti-sens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral présumé. Au cours de l’amplification, alors que les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est de l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du Sras-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST) [il s’agit d’une méthode de recherche heuristique utilisée en bioinformatique. Le BLAST permet de trouver les régions similaires entre deux ou plusieurs séquences de nucléotides ou d’acides aminés, et de réaliser un alignement de ces régions homologues – NdT]. Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc « BLASTER » [rechercher] les amorces, les sondes et les séquences de gènes cibles qui ont été déclarées dans la recherche du Sras-CoV-2.

Les amorces et les protocoles de sonde de l’OMS pour le génome viral présumé du Sras-CoV-2 sont basés sur les profils des gènes Rd-Rp, ORF1, N et E. N’importe qui peut les soumettre à l’analyse de BLAST et découvrir les résultats.

La séquence nucléotidique vitale Rd-RP, utilisée comme amorce avant, est — ATGAGCTTAGTCCTGTTG. Si nous lançons une recherche nucléotidique sur BLAST, celle-ci est enregistrée comme correspondant à l’isolation complète du Sras-CoV-2 avec une identité de séquence identique à 100 %. De même, la séquence d’amorce du gène E inverse — ATATTGCAGCAGTACGCACACA — révèle la présence de la séquence ORF1ab qui identifie également le Sras-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence Rd-Rp du Sras-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100 %. La recherche sur le ORF1ab (gène E) en trouve 90 avec une identité de séquence de 100 % avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes dont la séquence correspond à 100 % au gène du Sras-CoV-2 E, et 100 microbes dont la séquence correspond à 100 % au gène vital Rd-Rp du Sras-CoV-2 .

Chaque fois que nous vérifions les soi-disant marqueurs génétiques uniques au Sras-CoV-2 qui sont enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le Sras-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, depuis des séquences microbiennes jusqu’à des fragments de chromosomes humains.

Les soi-disant vérificateurs-de-faits (fact-checkers), comme le projet Health Feedback de Reuters, se sont empressés de rejeter les revendications de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du Sras-CoV-2. Ils utilisent une ribambelle d’arguments bidons comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), ce qui fait que leur tentative de démystification aboutit à quelque chose comme ça :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus Sras-CoV-2. De plus, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence d’ADNc entre les amorces est unique au virus. »

Cette façon de faire semble déformer de manière délibérée la portée des observations émises en amont en avançant un argument que personne, à part les vérificateurs-de-faits eux-mêmes, ne fait valoir. Les recherches effectuées sur BLAST montrent que ces séquences cibles ne sont pas uniques au Sras-CoV-2. Pas plus qu’il n’est nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont enquêté sur l’épidémiologie des cas marocains présumés du Sras-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs à aucun.

Ceci est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (TAAN) avec au moins deux cibles indépendantes du génome du Sras-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé […] Un ou plusieurs résultats négatifs n’excluent pas nécessairement une infection par le Sras-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs-de-faits grassement rémunérés, si les amorces avant et arrière identifient des débris, l’une identifiant peut-être le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée située entre elles est probablement aussi un débris.

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que dans le prétendu génome du Sras-CoV-2 l’entièreté des chromosomes ou des microbes sont séquencés. Même s’il est possible que ce soit effectivement le cas, pour ce que l’on en sait. Ce qui est avancé [par ceux qui interroge les méthodes de dépistage – NdT], c’est que les prétendus marqueurs utilisés pour tester ce supposé virus ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des occurrences de fluorescence de sondes spécifiques pour indiquer la présence de séquences supposées exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « poubelle » (ADNc).

Note de MKS

À propos de l’ADN « poubelle », voir cet article du Dr Gaby : « L’ADN « poubelle » viral, le régime cétogène qui améliore l’ADN et les effets cométaires ».

Par exemple, le gène S du Sras-CoV-2 est censé être hautement spécifique au génome du virus du Sras-CoV-2. La séquence cible est — TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100 %. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95 %. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100 % avec 86 fragments de chromosomes humains.

Quel que soit l’endroit où l’on regarde dans le supposé génome du Sras-CoV-2, rien dans les protocoles de test de l’OMS ne permet d’identifier clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du Sras-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas — et puisqu’il n’y a pas d’isolats ou d’échantillons purifiés du virus — aucune preuve de l’existence du Sras-CoV-2 sans test viable ne peut exister. Par conséquent, il n’existe pas non plus de preuve de l’existence d’une maladie appelée Covid-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de Covid-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Note de MKS

Sur rien de « scientifique », mais sur une nécessité psychopathique servie par une certaine science, sans aucun doute.

Fraude et conspiration

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre. »

La définition juridique d’une conspiration est la suivante

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel. »

Il semblerait que ceux qui prétendent que nous sommes confrontés à une « pandémie » n’aient fourni aucune preuve montrant qu’un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Toutes les informations suggérant fortement qu’une telle probabilité existe sont facilement accessibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations à des fins frauduleuses, il s’agit alors d’une conspiration (dans les pays qui appliquent la Common law) ou d’une entreprise criminelle commune en vertu du Droit international.

Note de MKS

La Common law est système juridique anglo-saxon dont les règles sont principalement édictées par les tribunaux au fur et à mesure des décisions individuelles, et non sur le Droit civil comme en France qui s’appuie sur le Droit codifié — encore que la France fait de plus en plus souvent fi du Droit codifié pour le remplacer par la Common law, dont la jurisprudence a toujours été l’élément fondamental. Généralement, les pays sous la Common law sont les anciennes colonies ou les anciens protectorats britanniques y compris les Etats-Unis (à la seule exception de la Louisiane où s’applique un droit codifié.)

Il semble que le Covid-19 ait été délibérément utilisé comme casus belli pour mener une guerre contre l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de flâner a été restreinte, la liberté de parole et d’expression a été érodée, les droits de manifester ont été réduits, nous avons été séparés de nos proches, et nos sociétés ont été détruites, soumises à des assauts psychologiques, muselées et terrorisées.

Le Prince Charles nous demande d’accueillir la Grande réinitialisation à bras ouverts

Pire encore, alors qu’il n’existe pas de preuve d’une mortalité sans précédent toutes causes confondues, on a enregistré des pics de mortalité anormaux. Ces pics correspondent précisément aux mesures de « confinement » qui ont entraîné une interruption des soins de santé primaires et une réorientation des services de santé publique financés par nos impôts pour traiter à l’exclusion de toutes les autres une prétendue maladie.

En outre, ceux qui ont présenté et fait circuler le récit Covid-19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à leur soi-disant « nouvelle normalité » [ou nouvelle réalité, soit leur pseudo-réalité – NdT], à savoir la transformation complète sans notre consentement de toute notre société, ils exigent que nous nous soumettions à leurs conditions.

Ces mesures comprennent, sans s’y limiter, une surveillance biométrique de chacun, un contrôle et un suivi centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives, jusqu’à celle qui exige clairement que nous renoncions à toute forme de souveraineté sur nos propres corps. Toutes ces mesures constituent les conditions qui prévalent dans l’esclavage.

Il ne fait aucun doute que nos droits ont été bafoués et que nous en avons été dépouillés. Dans les pays qui exercent la Common law, l’innocence est présumée, mais il n’empêche que les preuves d’un préjudice délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, émanent clairement de think tanks mondialistes et d’institutions supranationales, et ont été élaborées bien avant l’émergence de cette soi-disant pandémie.

Dans les pays soumis au Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils faudrait qu’ils puissent prouver que, en dépit de leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le Covid-19 est un mythe.

Note de MKS

Le Code Napoléon est aussi appelé Code civil, et la présomption d’innocence est le principe selon lequel toute personne, qui se voit reprocher une infraction, est réputée innocente tant que sa culpabilité n’a pas été légalement démontrée. La plupart des pays d’Europe reconnaissent et utilisent le principe de la présomption d’innocence selon l’article 6 de la Convention européenne des droits de l’homme. Toutefois, il est des cas, tout du moins en France, où la présomption de culpabilité existe en vertu des exceptions au droit à la présomption d’innocence. Ces exceptions sont légales et la charge de la preuve de la non-culpabilité repose alors sur le prévenu.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source de l’article initialement publié en anglais le 16 novembre 2020 : In This Together

traduit par Sott.net

*

Alors, fraude totale ou partielle ?

Si l’on part du principe, comme postulé ici, que le Sras-Cov-2 est d’origine humaine, et qu’il est donc « réel », faut-il donc en déduire que le séquençage qui en a été fait est faux, bidouillé, falsifié, suffisamment pour en cacher certains éléments, parmi ceux qui pourraient servir les psychopathes au pouvoir, mais pas assez pour en révéler certains aspects ? Encore que les éléments de preuve développés dans « Les preuves irréfutables de l’origine humaine du Sras-Cov-2 » proposent justement d’y répondre :

« Nous avons tout au long de cet article examiné les preuves suggérant que le Sras-Cov-2 a été fabriqué à Fort Detrick et qu’il a été incorporé dans un vaccin dans le but explicite de se propager à grande échelle et d’affecter les fonctions neurologiques associées à l’obéissance.

Il semble que ce projet ait toutefois échoué, d’abord parce que le « virus de l’obéissance » a muté en un « virus de la désobéissance », ce qui a contraint les pouvoirs publics à prendre — à tout prix — des mesures hâtives en vue de limiter la propagation du mutant bénéfique.

Le confinement général fut une tentative désespérée de minimiser la propagation des effets potentiellement bénéfiques de la mutation du Sras-Cov-2. »

Au départ, il y a une fabrication. Puis s’en est suivi une mutation. Le séquençage « officiel » du Sras-Cov-2 correspond-il au virus initial ou à sa mutation ? Ou à un autre « état » intermédiaire ?

Quoiqu’il en soit, c’est une question à laquelle il est pour le moment difficile de répondre, et il est possible que nous n’en saurons jamais rien. Nous avons plus que certainement des lacunes tant techniques que factuelles pour comprendre les tenants (mais pas les aboutissants) de tout ceci. Tout ce que nous savons, à ce stade, c’est que ce virus est utilisé pour tenter d’imposer aux populations terrorisées un monde dystopique — par le biais notamment d’un programme économique et politique totalitaire qui se propose d’avancer des conjectures et des théories malsaines sur ce à quoi le monde post-soi-disant-pandémique devrait ressembler.

« Faites-vous vacciner pour protéger les autres ! » « Pas de vaccin = pas de travail, pas de shopping, pas de voyage, pas de socialisation ! ». En gros, vous êtes libre de choisir entre le passeport d’immunité ou une peine de prison à vie dans une cellule isolée.

Pour conclure, qu’est-ce que la « science » ? Selon Nissim Amzallag :

« La science ne distille pas forcément le vrai, cela nous le savons depuis le début du XXe siècle. Et pourtant, une aura d’objectivité continue de protéger la science de toute critique non seulement sur ses fondements, mais encore sur la manière dont elle s’impose pour façonner la société. »

L’auteur dans son ouvrage La réforme du vrai — Enquête sur les sources de la modernité, publié en 2010 aux Éditions Charles Léopold Mayer, « explore les fondements sur lesquels s’est appuyée la révolution scientifique et les métamorphoses qu’elle a induites dans la société. » Nissim Amzallag plonge dans des considérations historiques pour essayer de comprendre si la science naissante, dite moderne depuis la pomme de Newton (mythe fondateur, s’il en est), « fut réellement motivée par un désir sincère d’intelligence du réel ». C’est loin d’être le cas :

« les innovations les plus importantes, conceptuelles comme pratiques, dérivent de parti pris étrangers à toute exigence du réel ».

Son livre s’adresse à tous ceux qui souhaitent s’émanciper « de l’autorité d’une idéologie maquillée en savoir » en prenant conscience de l’existence d’une réforme du vrai. Ou devrait-on l’appeler « réforme du réel » ? En effet, il est difficile, quand on les connaît toutes les deux, de ne pas faire le lien entre l’existence des pseudo-réalités psychopathiques et la réforme du vrai de l’auteur, une réforme qui permet justement la mise en place de la dite pseudo-réalité. Dans son ouvrage, il en aborde en 2010 toutes les étapes sauf celle, finale, mais vouée à l’échec de par sa nature utopique, que nous expérimentons aujourd’hui.

source : https://fr.sott.net/article
via : https://reseauinternational.net/covid-19-et-sras-cov-2-les-preuves-dune-fraude-globale/

Céline et la soumission imbécile du Français

par Nicolas Bonnal.

On entend ici et là qu’on va réagir, qu’on est le pays des rebelles, des droits de l’homme, de la liberté, des tranchées et qu’on va voir ce qu’on va voir à propos du vaccin, du masque, du confinement.

Je répète : jouez aux rebelles quinze secondes, vous qui me jetez la pierre, dans le métro, à l’école, au boulot. Il n’y a pas 30% de mécontents ou d’insoumis dans ce pays, mais 1%. Et ça dépend des jours et du sujet

Une amie m’a écrit hier :

« J’entendais hier un général de gendarmerie, étonné de la « docilité » des Français (à propos du couvre-feu), qui disait qu’en réalité on n’aurait pas le choix. Carnet vaccinal obligatoire pour voyager ; pour se soigner et aller à l’hosto idem ; pour travailler encore, les administrations demanderont à leurs employés de se faire vacciner (et je doute que le privé soit en reste) ; bref ce que tu dis depuis des mois ».

C’est ce que je dis depuis des mois parce que c’est ce qui se passe depuis des siècles.

Tout pays de la liberté se croit plus libre au fur et à mesure qu’il s’enferme dans les réseaux inextricables des lois. Maistre rappelait en 1789 qu’on avait eu plus de lois en un an qu’en mille.

Quelques rappels céliniens alors. C’est ma monographie la plus lue – avec celle de Tolkien – et elle est lue par des gens qui ont compris que Céline ne parle pas des juifs (sujet éculé tout de même) mais des Français :

« Il règne sur tout ce pays, au tréfonds de toute cette viande muselée, un sentiment de gentillesse sacrificielle, de soumission, aux pires boucheries, de fatalisme aux abattoirs, extraordinairement dégueulasse. Qui mijote, sème, propage, fricote, je vous le demande, magnifie, pontifie, virulise, sacremente cette saloperie suicidaire ? Ne cherchez pas ! Nos farceurs gueulards imposteurs Patriotes, notre racket nationaliste, nos chacals provocateurs, nos larrons maçons, internationalistes, salonneux, communistes, patriotes à tout vendre, tout mentir, tout provoquer, tout fourguer, transitaires en toutes viandes, maquereaux pour toutes catastrophes. Patriotes pour cimetières fructueux. Des vrais petits scorpions apocalyptiques qui ne reluisent qu’à nous faire crever, à nous fricoter toujours de nouveaux Déluges ».

Céline a compris que le Français n’est pas une victime de Macron, Hollande ou Sarkozy, du comité des forges ou du mondialisme ou de Bruxelles : le Français est un enthousiaste. On le laisse cracher le morceau (à Céline) :

« Plus de Loges que jamais en coulisse, et plus actives que jamais. Tout ça plus décidé que jamais à ne jamais céder un pouce de ses Fermes, de ses Privilèges de traite des blancs par guerre et paix jusqu’au dernier soubresaut du dernier paumé d’indigène. Et les Français sont bien contents, parfaitement d’accord, enthousiastes ».

Cela c’était avant 39. Pour aujourd’hui aussi ces lignes résonnent furieusement (pensez à ces queues d’andouilles voulant être testées cet été…) :

« Une telle connerie dépasse l’homme. Une hébétude si fantastique démasque un instinct de mort, une pesanteur au charnier, une perversion mutilante que rien ne saurait expliquer sinon que les temps sont venus, que le Diable nous appréhende, que le Destin s’accomplit ».

Certains nous font le coup à la mode Maurras du grand recours, de la divine surprise (Trump…). On a vu la lâcheté incisive des femmes Le Pen. Céline savait ce qu’il en coûtait de se fier aux patriotes, aux nationalistes et autres, toujours les premiers à offrir leur poitrine aux démocraties, comme disait Bernanos. Et de rentrer dedans :

« Dans nos démocraties larbines, ça n’existe plus les chefs patriotes. En lieu et place c’est des effrontés imposteurs, tambourineurs prometteurs « d’avantages », de petites et grandes jouissances, des maquereaux « d’avantages ». Ils hypnotisent la horde des « désirants », aspirants effrénés, bulleux « d’avantages ». Pour l’adoption d’un parti, d’un programme, c’est comme pour le choix d’un article au moment des « réclames », on se décide pour le magasin qui vous promet le plus « d’avantages ». Je connais moi des personnes, des véritables affranchis qui sont en même temps marxistes, croix-de-feu, francs-maçons, syndiqués très unitaires et puis malgré tout, quand même, encore partisans du curé, qui font communier leurs enfants. C’est des camarades raisonnables, pas des fous, qui veulent perdre dans aucun tableau, qui se défendent à la martingale, des Idéologues de Loterie, très spécifiquement français. Quand ça devient des racailles pareilles y a plus besoin de se gêner ».

Cela s’applique aussi au Bayrou, catho, bourgeois, six enfants, qui nous prépare le passeport vaccinal et la grande confiscation dans un bâillement/acquiescement général.

Céline remet notre occident démocrate – qui retombe dans son terrorisme/bolchévisme initial, ici ou en Amérique – à sa place :

« La conjuration mondiale seule véritable réussite de notre civilisation. Nous n’avons plus de patriotes. C’est un regret de bétail, on en a presque jamais eu de patriotes. On nous a jamais laissé le temps. D’une trahison dans une autre, on a jamais eu le temps de souffler… D’une guerre dans une autre… »

Après on est vendus aux étrangers mais c’est depuis des siècles (pensez à Concini dans le Capitan…) :

« On nous a toujours trafiqués, vendus comme des porcs, comme des chiens, à quelque pouvoir hostile pour les besoins d’une politique absolument étrangère, toujours désastreuse. Nos maîtres ont toujours été, à part très rares exceptions, à la merci des étrangers. Jamais vraiment des chefs nationaux, toujours plus ou moins maçons, jésuites, papistes, juifs… »

Parti de l’ordre, parti catholique, parti social-démocrate, parti européen, parti pro-américain, parti prosoviétique, on n’en finirait pas… Comme on sait dans le dernier pamphlet Céline a compris que le problème français est insoluble, plus fort que prévu, et que « bouffer du juif ne suffit plus » ! Il était temps Ferdinand !

Qui a envie de bouffer du Zemmour, du Toubiana, du Kunstler, du Greenwald ? En pourcentage il y a plus de juifs que de goys antisystèmes. 10% dans un cas, un pour dix mille dans l’autre.

Un autre antisémite qui a enfin compris les Français c’est Drumont. Et dans son Testament, très supérieur à la France juive, il écrivait le vieil Édouard :

« Quand les conquérants germains et francs qui, unis aux purs Gaulois et aux Celtes, constituèrent véritablement la France eurent perdu leur vigueur, l’élément gallo-romain l’emporta, la race latine reprit le dessus ; or, cette race est faite pour la tyrannie, puisqu’elle n’a aucun ressort de conscience ; elle adore une idole imbécile, une idole de marbre ou de plâtre qu’on appelle la Loi, et au nom de cette Loi, elle subit tout ».

Ensuite Drumont l’explique cette ludique loi gallo-romaine :

« La Loi, c’est le licteur qui vient de la part de César annoncer au citoyen romain qu’il est condamné à mourir, mais qu’on lui laisse le choix du supplice ; c’est le gendarme de la Révolution qui vient parfois tout seul arrêter cinq ou six personnes et qui les conduit au Luxembourg ou à la Conciergerie, où un autre gendarme vient les chercher pour les conduire à la guillotine. Jamais il n’est entré dans la cervelle de ceux qu’on arrêtait ainsi, l’idée de commencer par tuer le gendarme. C’est là un spectacle extraordinaire et il n’y a jamais qu’en France qu’un gouvernement ait pu s’appeler, comme par une désignation constitutionnelle: la Terreur ».

Revenons à Céline et à la docilité du colonel de gendarmerie cité plus haut :

« Les Français subiront leur sort, ils seront mis, un jour, à la sauce vinasse… Ils le sont déjà. Pas d’erreur !… Le conquérant doit être sûr de ses esclaves en tous lieux, toujours en mains, sordidement soumis, il doit être certain de pouvoir les lancer, au jour choisi, parfaitement hébétés… dociles… jusqu’ aux os… gâteux de servitude, dans les plus ronflants, rugissants fours à viande… sans que jamais ils regimbent, sans qu’un seul poil de ce troupeau ne se dresse d’hésitation, sans qu’il s’échappe de cette horde le plus furtif soupçon de plainte… »

C’est lui qui qualifie nos monuments aux morts de lourds dolmens de la docilité…

________

sources : Nicolas Bonnal – Céline, Le pacifiste enragé

ajax-loader